Incidental Mutation 'R7144:Nbeal1'
ID 553591
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Name neurobeachin like 1
Synonyms A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 045328-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 60219758-60377487 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 60276310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 684 (V684L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]
AlphaFold E9PYP2
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160980
SMART Domains Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 278 297 N/A INTRINSIC
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,032,796 (GRCm39) I272F possibly damaging Het
Adcy10 G T 1: 165,337,939 (GRCm39) M184I probably benign Het
Aldoa G T 7: 126,396,034 (GRCm39) T124N possibly damaging Het
Ap4e1 T A 2: 126,853,727 (GRCm39) I55N probably damaging Het
Arhgap21 T C 2: 20,870,198 (GRCm39) T913A probably benign Het
Atrnl1 G A 19: 58,030,784 (GRCm39) E1309K probably damaging Het
BC034090 A T 1: 155,117,777 (GRCm39) C114S probably damaging Het
Brinp2 A G 1: 158,122,994 (GRCm39) probably null Het
Ccn4 T A 15: 66,784,879 (GRCm39) V184E probably damaging Het
Ccna1 G T 3: 54,953,120 (GRCm39) H408Q probably benign Het
Cd209g T G 8: 4,185,189 (GRCm39) probably benign Het
Cdc20b A G 13: 113,219,905 (GRCm39) I433V probably benign Het
Cdk2ap1 G A 5: 124,492,421 (GRCm39) P5L probably damaging Het
Cep128 T C 12: 91,260,933 (GRCm39) E310G probably damaging Het
Cflar G T 1: 58,793,007 (GRCm39) V458F Het
Clec4b2 A G 6: 123,158,343 (GRCm39) T70A probably benign Het
Cntnap5c A G 17: 58,593,883 (GRCm39) T741A probably benign Het
Csf3r A T 4: 125,937,515 (GRCm39) T800S probably benign Het
Csnk1g2 T C 10: 80,473,733 (GRCm39) Y67H probably damaging Het
Cyp2c67 A T 19: 39,604,138 (GRCm39) V406E probably benign Het
Dnah10 A G 5: 124,900,006 (GRCm39) D3868G probably damaging Het
Dnah7a A T 1: 53,737,867 (GRCm39) probably null Het
Dst A G 1: 34,191,324 (GRCm39) N208S probably damaging Het
Echdc3 A G 2: 6,211,224 (GRCm39) probably null Het
Edrf1 T C 7: 133,239,578 (GRCm39) S13P probably benign Het
Ephb1 T C 9: 101,841,276 (GRCm39) Y734C probably damaging Het
Eps8l1 A G 7: 4,475,184 (GRCm39) Y325C probably damaging Het
Evc2 A G 5: 37,544,183 (GRCm39) D644G probably damaging Het
Eya4 A C 10: 23,048,943 (GRCm39) D54E probably benign Het
Filip1 T C 9: 79,727,495 (GRCm39) S375G possibly damaging Het
Fmo9 A G 1: 166,505,189 (GRCm39) M68T probably benign Het
Gemin5 G C 11: 58,032,489 (GRCm39) P772A probably benign Het
Gle1 T G 2: 29,833,805 (GRCm39) C401G probably damaging Het
Gm7298 A T 6: 121,738,546 (GRCm39) I376F probably damaging Het
Gpr35 A C 1: 92,910,353 (GRCm39) I22L probably benign Het
Grin2b T G 6: 135,710,474 (GRCm39) D1024A possibly damaging Het
Hmcn1 T C 1: 150,539,624 (GRCm39) N2956D probably damaging Het
Htt T C 5: 35,003,350 (GRCm39) L1275P probably damaging Het
Ibtk T C 9: 85,625,744 (GRCm39) D2G probably benign Het
Il16 T A 7: 83,295,659 (GRCm39) D1170V probably damaging Het
Iqgap3 T A 3: 88,024,217 (GRCm39) I1513N probably damaging Het
Kiz T G 2: 146,792,430 (GRCm39) probably null Het
Krt12 A T 11: 99,306,839 (GRCm39) *488K probably null Het
Lap3 A T 5: 45,654,290 (GRCm39) T83S probably benign Het
Lars2 T A 9: 123,261,058 (GRCm39) S410T probably damaging Het
Limch1 A G 5: 67,175,001 (GRCm39) T518A probably benign Het
Lrrc49 A T 9: 60,522,439 (GRCm39) S381T probably damaging Het
Lrrk2 A G 15: 91,618,258 (GRCm39) D919G possibly damaging Het
Mmp1a A T 9: 7,475,319 (GRCm39) S363C probably damaging Het
Mrps22 A C 9: 98,483,524 (GRCm39) probably null Het
Mybpc3 T C 2: 90,964,949 (GRCm39) I1066T probably benign Het
Myo10 A T 15: 25,724,011 (GRCm39) N215I probably damaging Het
Myocd A C 11: 65,109,474 (GRCm39) L99R probably damaging Het
Nadk T G 4: 155,673,793 (GRCm39) I394S probably damaging Het
Nadsyn1 T C 7: 143,364,952 (GRCm39) N251S probably damaging Het
Ncapd2 G A 6: 125,153,633 (GRCm39) P694L probably benign Het
Or2ag1 T A 7: 106,473,075 (GRCm39) I126F probably damaging Het
Or2w3b A C 11: 58,623,571 (GRCm39) L140R probably damaging Het
Or4a71 T C 2: 89,357,901 (GRCm39) I284M probably damaging Het
Or5t16 G T 2: 86,819,164 (GRCm39) R119S probably damaging Het
Pcdhb13 T A 18: 37,576,309 (GRCm39) I229K probably damaging Het
Pgbd5 A T 8: 125,101,056 (GRCm39) M400K possibly damaging Het
Phactr3 A G 2: 177,944,529 (GRCm39) N409S probably damaging Het
Pik3c2g C A 6: 139,606,868 (GRCm39) P305Q probably damaging Het
Pik3r4 G A 9: 105,527,783 (GRCm39) V379M probably damaging Het
Pira12 A G 7: 3,900,615 (GRCm39) V45A probably damaging Het
Pkd1l2 A T 8: 117,802,870 (GRCm39) C250* probably null Het
Pramel14 A C 4: 143,718,103 (GRCm39) S447A probably benign Het
Rapgef6 A C 11: 54,548,191 (GRCm39) T792P possibly damaging Het
Rexo5 A G 7: 119,404,414 (GRCm39) D170G probably damaging Het
Rnf17 G A 14: 56,749,789 (GRCm39) probably null Het
Septin11 A G 5: 93,304,725 (GRCm39) I181V probably benign Het
Serpina1e T G 12: 103,913,277 (GRCm39) *414C probably null Het
Serpine1 C A 5: 137,099,918 (GRCm39) Q80H probably damaging Het
Sh3bp2 A G 5: 34,718,975 (GRCm39) N560S probably benign Het
Slc25a25 A G 2: 32,309,178 (GRCm39) F221S probably damaging Het
Spag17 G T 3: 99,934,717 (GRCm39) probably null Het
Sspn T C 6: 145,906,881 (GRCm39) L104P probably damaging Het
St18 A C 1: 6,903,818 (GRCm39) E693A probably damaging Het
St6galnac3 T C 3: 153,117,169 (GRCm39) I185V possibly damaging Het
St8sia1 T C 6: 142,822,395 (GRCm39) D156G probably damaging Het
Syne2 C A 12: 76,052,152 (GRCm39) S4092R probably benign Het
Tll1 T A 8: 64,577,979 (GRCm39) D76V possibly damaging Het
Tmco1 C T 1: 167,136,022 (GRCm39) probably benign Het
Tnfaip3 T A 10: 18,883,029 (GRCm39) T179S probably benign Het
Trav16 T C 14: 53,981,096 (GRCm39) I95T possibly damaging Het
Trip12 A T 1: 84,771,435 (GRCm39) S280T probably damaging Het
Unc79 A G 12: 103,108,885 (GRCm39) M2166V probably benign Het
Vmn2r1 A G 3: 63,997,362 (GRCm39) I339M probably damaging Het
Vwa5b1 A G 4: 138,332,742 (GRCm39) probably null Het
Washc4 A T 10: 83,409,638 (GRCm39) probably null Het
Wiz A G 17: 32,576,602 (GRCm39) S642P possibly damaging Het
Zeb2 T A 2: 45,000,053 (GRCm39) K60N possibly damaging Het
Zfat T A 15: 68,050,631 (GRCm39) T797S probably benign Het
Zfp74 T C 7: 29,634,590 (GRCm39) K373E probably damaging Het
Zswim5 T C 4: 116,833,173 (GRCm39) probably null Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60,274,350 (GRCm39) nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60,321,042 (GRCm39) missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60,367,262 (GRCm39) missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60,256,384 (GRCm39) missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60,220,900 (GRCm39) missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60,234,170 (GRCm39) critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60,234,302 (GRCm39) missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60,274,512 (GRCm39) missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60,320,500 (GRCm39) missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60,281,784 (GRCm39) critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60,269,787 (GRCm39) missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60,281,784 (GRCm39) critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60,256,414 (GRCm39) missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60,281,694 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60,311,418 (GRCm39) critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60,292,660 (GRCm39) missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60,368,494 (GRCm39) missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60,274,396 (GRCm39) missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60,323,146 (GRCm39) missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60,326,603 (GRCm39) splice site probably benign
IGL02945:Nbeal1 APN 1 60,245,569 (GRCm39) missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60,292,572 (GRCm39) missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60,317,886 (GRCm39) missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60,275,618 (GRCm39) missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60,274,027 (GRCm39) missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60,274,028 (GRCm39) missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60,300,745 (GRCm39) critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60,281,726 (GRCm39) nonsense probably null
coach UTSW 1 60,292,640 (GRCm39) nonsense probably null
Committee UTSW 1 60,332,062 (GRCm39) missense probably damaging 1.00
Disgrace UTSW 1 60,320,469 (GRCm39) nonsense probably null
Dravrah UTSW 1 60,323,251 (GRCm39) missense probably damaging 1.00
Harvard UTSW 1 60,274,722 (GRCm39) splice site probably null
horrified UTSW 1 60,283,983 (GRCm39) missense probably damaging 1.00
Lampoon UTSW 1 60,300,745 (GRCm39) critical splice donor site probably null
lawyer UTSW 1 60,349,383 (GRCm39) nonsense probably null
magistrate UTSW 1 60,233,756 (GRCm39) critical splice donor site probably null
Maratimus UTSW 1 60,331,047 (GRCm39) missense probably damaging 1.00
National UTSW 1 60,261,422 (GRCm39) missense possibly damaging 0.95
phainopepla UTSW 1 60,358,846 (GRCm39) missense probably damaging 1.00
R3875_Nbeal1_770 UTSW 1 60,233,758 (GRCm39) splice site probably benign
satirical UTSW 1 60,274,721 (GRCm39) critical splice donor site probably null
silky UTSW 1 60,370,037 (GRCm39) splice site probably benign
stiggs UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60,303,431 (GRCm39) splice site probably benign
P0007:Nbeal1 UTSW 1 60,358,847 (GRCm39) missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60,331,096 (GRCm39) missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60,321,030 (GRCm39) missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60,349,422 (GRCm39) missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60,267,771 (GRCm39) splice site probably benign
R0054:Nbeal1 UTSW 1 60,326,560 (GRCm39) utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60,286,876 (GRCm39) missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60,286,876 (GRCm39) missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60,344,468 (GRCm39) missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60,344,529 (GRCm39) splice site probably benign
R0324:Nbeal1 UTSW 1 60,332,032 (GRCm39) missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60,307,222 (GRCm39) missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60,307,222 (GRCm39) missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60,286,893 (GRCm39) missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60,307,598 (GRCm39) missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60,320,991 (GRCm39) nonsense probably null
R1034:Nbeal1 UTSW 1 60,329,165 (GRCm39) nonsense probably null
R1082:Nbeal1 UTSW 1 60,351,385 (GRCm39) missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60,299,428 (GRCm39) missense probably benign
R1187:Nbeal1 UTSW 1 60,233,687 (GRCm39) missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60,240,098 (GRCm39) missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60,344,450 (GRCm39) missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60,239,278 (GRCm39) missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60,299,493 (GRCm39) missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60,323,251 (GRCm39) missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60,307,100 (GRCm39) nonsense probably null
R1952:Nbeal1 UTSW 1 60,273,999 (GRCm39) missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60,273,999 (GRCm39) missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60,245,503 (GRCm39) missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60,358,846 (GRCm39) missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60,332,123 (GRCm39) splice site probably null
R2055:Nbeal1 UTSW 1 60,350,216 (GRCm39) missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60,309,515 (GRCm39) missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60,344,430 (GRCm39) splice site probably null
R2181:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60,321,054 (GRCm39) missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60,323,165 (GRCm39) missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60,370,037 (GRCm39) splice site probably benign
R2268:Nbeal1 UTSW 1 60,370,037 (GRCm39) splice site probably benign
R2351:Nbeal1 UTSW 1 60,276,257 (GRCm39) missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60,290,511 (GRCm39) missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60,290,529 (GRCm39) missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60,290,572 (GRCm39) splice site probably benign
R3747:Nbeal1 UTSW 1 60,234,182 (GRCm39) missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60,233,758 (GRCm39) splice site probably benign
R4119:Nbeal1 UTSW 1 60,331,029 (GRCm39) missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60,370,107 (GRCm39) missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60,329,105 (GRCm39) missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60,306,933 (GRCm39) missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60,320,469 (GRCm39) nonsense probably null
R4618:Nbeal1 UTSW 1 60,267,890 (GRCm39) intron probably benign
R4673:Nbeal1 UTSW 1 60,368,549 (GRCm39) missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60,274,722 (GRCm39) splice site probably null
R4798:Nbeal1 UTSW 1 60,261,352 (GRCm39) splice site probably null
R4826:Nbeal1 UTSW 1 60,290,501 (GRCm39) missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60,292,534 (GRCm39) missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60,292,534 (GRCm39) missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60,332,062 (GRCm39) missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60,277,813 (GRCm39) missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60,276,338 (GRCm39) missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60,309,487 (GRCm39) missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60,274,718 (GRCm39) nonsense probably null
R5345:Nbeal1 UTSW 1 60,367,369 (GRCm39) critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60,350,158 (GRCm39) missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60,316,353 (GRCm39) missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60,276,311 (GRCm39) missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60,281,761 (GRCm39) missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60,331,006 (GRCm39) missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60,311,380 (GRCm39) missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60,267,950 (GRCm39) intron probably benign
R5918:Nbeal1 UTSW 1 60,307,051 (GRCm39) missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60,287,554 (GRCm39) missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60,287,564 (GRCm39) missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60,220,715 (GRCm39) start gained probably benign
R6113:Nbeal1 UTSW 1 60,261,422 (GRCm39) missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60,290,466 (GRCm39) missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60,296,643 (GRCm39) missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60,261,287 (GRCm39) missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60,335,083 (GRCm39) missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60,287,524 (GRCm39) missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60,277,878 (GRCm39) missense probably benign
R6457:Nbeal1 UTSW 1 60,292,633 (GRCm39) missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60,370,101 (GRCm39) missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60,320,469 (GRCm39) nonsense probably null
R7021:Nbeal1 UTSW 1 60,300,745 (GRCm39) critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60,350,106 (GRCm39) missense probably damaging 1.00
R7145:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60,299,793 (GRCm39) nonsense probably null
R7157:Nbeal1 UTSW 1 60,276,317 (GRCm39) missense probably damaging 1.00
R7209:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60,240,110 (GRCm39) missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60,349,383 (GRCm39) nonsense probably null
R7312:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60,256,355 (GRCm39) missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60,283,969 (GRCm39) missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60,233,756 (GRCm39) critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60,300,743 (GRCm39) missense probably benign
R7507:Nbeal1 UTSW 1 60,274,626 (GRCm39) missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60,316,386 (GRCm39) missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60,283,983 (GRCm39) missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60,296,609 (GRCm39) missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60,358,500 (GRCm39) missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60,331,048 (GRCm39) missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60,299,591 (GRCm39) missense probably benign
R7902:Nbeal1 UTSW 1 60,331,029 (GRCm39) missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60,299,431 (GRCm39) nonsense probably null
R8053:Nbeal1 UTSW 1 60,318,954 (GRCm39) missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60,239,292 (GRCm39) missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60,292,640 (GRCm39) nonsense probably null
R8209:Nbeal1 UTSW 1 60,316,336 (GRCm39) missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60,316,336 (GRCm39) missense probably damaging 0.99
R8549:Nbeal1 UTSW 1 60,274,721 (GRCm39) critical splice donor site probably null
R8560:Nbeal1 UTSW 1 60,274,316 (GRCm39) missense probably benign 0.38
R8753:Nbeal1 UTSW 1 60,307,542 (GRCm39) missense probably damaging 1.00
R8769:Nbeal1 UTSW 1 60,274,370 (GRCm39) missense probably damaging 0.99
R8771:Nbeal1 UTSW 1 60,300,743 (GRCm39) missense probably benign
R8952:Nbeal1 UTSW 1 60,299,459 (GRCm39) missense probably benign 0.01
R9014:Nbeal1 UTSW 1 60,329,118 (GRCm39) missense probably damaging 1.00
R9056:Nbeal1 UTSW 1 60,317,885 (GRCm39) missense probably damaging 1.00
R9091:Nbeal1 UTSW 1 60,307,548 (GRCm39) missense possibly damaging 0.50
R9138:Nbeal1 UTSW 1 60,286,904 (GRCm39) nonsense probably null
R9168:Nbeal1 UTSW 1 60,331,047 (GRCm39) missense probably damaging 1.00
R9200:Nbeal1 UTSW 1 60,320,425 (GRCm39) missense probably damaging 1.00
R9205:Nbeal1 UTSW 1 60,317,839 (GRCm39) missense probably damaging 1.00
R9270:Nbeal1 UTSW 1 60,307,548 (GRCm39) missense possibly damaging 0.50
R9322:Nbeal1 UTSW 1 60,297,818 (GRCm39) missense possibly damaging 0.91
R9405:Nbeal1 UTSW 1 60,349,424 (GRCm39) missense probably damaging 1.00
R9554:Nbeal1 UTSW 1 60,290,287 (GRCm39) nonsense probably null
R9557:Nbeal1 UTSW 1 60,274,509 (GRCm39) missense probably benign
R9560:Nbeal1 UTSW 1 60,368,544 (GRCm39) missense probably damaging 1.00
R9641:Nbeal1 UTSW 1 60,350,247 (GRCm39) missense probably damaging 1.00
R9784:Nbeal1 UTSW 1 60,299,741 (GRCm39) nonsense probably null
X0022:Nbeal1 UTSW 1 60,316,391 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- GTCTTTGGCTTTGCTGAACC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'
Posted On 2019-05-15