Mutagenetix > Incidental Mutation

Incidental Mutation 'R7144:Nbeal1'

553591

Institutional Source

Beutler Lab

Gene Symbol

Nbeal1

Ensembl Gene

ENSMUSG00000073664

Gene Name

neurobeachin like 1

Synonyms

A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik

MMRRC Submission

045328-MU

Accession Numbers

Genbank: NM_173444; MGI: 2444343

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60180599-60338328 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 60237151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 684 (V684L)

Ref Sequence

ENSEMBL: ENSMUSP00000124056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]

AlphaFold

E9PYP2

Predicted Effect

probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

Domain	Start	End	E-Value	Type
low complexity region	522	541	N/A	INTRINSIC
Pfam:Laminin_G_3	567	801	8.3e-9	PFAM
low complexity region	1383	1401	N/A	INTRINSIC
low complexity region	1849	1865	N/A	INTRINSIC
Pfam:PH_BEACH	1882	1975	4.9e-32	PFAM
Beach	1998	2278	7.2e-199	SMART
Blast:Beach	2342	2405	6e-30	BLAST
WD40	2425	2463	5.52e-2	SMART
WD40	2475	2514	4.95e-4	SMART
WD40	2604	2649	7.64e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160980

SMART Domains

Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

Domain	Start	End	E-Value	Type
low complexity region	278	297	N/A	INTRINSIC

Meta Mutation Damage Score

0.1198

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (95/96)

Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,433,573	I272F	possibly damaging	Het
Adcy10	G	T	1: 165,510,370	M184I	probably benign	Het
Aldoa	G	T	7: 126,796,862	T124N	possibly damaging	Het
Ap4e1	T	A	2: 127,011,807	I55N	probably damaging	Het
Arhgap21	T	C	2: 20,865,387	T913A	probably benign	Het
Atrnl1	G	A	19: 58,042,352	E1309K	probably damaging	Het
BC034090	A	T	1: 155,242,031	C114S	probably damaging	Het
Brinp2	A	G	1: 158,295,424		probably null	Het
Ccna1	G	T	3: 55,045,699	H408Q	probably benign	Het
Cd209g	T	G	8: 4,135,189		probably benign	Het
Cdc20b	A	G	13: 113,083,371	I433V	probably benign	Het
Cdk2ap1	G	A	5: 124,354,358	P5L	probably damaging	Het
Cep128	T	C	12: 91,294,159	E310G	probably damaging	Het
Cflar	G	T	1: 58,753,848	V458F		Het
Clec4b2	A	G	6: 123,181,384	T70A	probably benign	Het
Cntnap5c	A	G	17: 58,286,888	T741A	probably benign	Het
Csf3r	A	T	4: 126,043,722	T800S	probably benign	Het
Csnk1g2	T	C	10: 80,637,899	Y67H	probably damaging	Het
Cyp2c67	A	T	19: 39,615,694	V406E	probably benign	Het
Dnah10	A	G	5: 124,822,942	D3868G	probably damaging	Het
Dnah7a	A	T	1: 53,698,708		probably null	Het
Dst	A	G	1: 34,152,243	N208S	probably damaging	Het
Echdc3	A	G	2: 6,206,413		probably null	Het
Edrf1	T	C	7: 133,637,849	S13P	probably benign	Het
Ephb1	T	C	9: 101,964,077	Y734C	probably damaging	Het
Eps8l1	A	G	7: 4,472,185	Y325C	probably damaging	Het
Evc2	A	G	5: 37,386,839	D644G	probably damaging	Het
Eya4	A	C	10: 23,173,045	D54E	probably benign	Het
Filip1	T	C	9: 79,820,213	S375G	possibly damaging	Het
Fmo9	A	G	1: 166,677,620	M68T	probably benign	Het
Gemin5	G	C	11: 58,141,663	P772A	probably benign	Het
Gle1	T	G	2: 29,943,793	C401G	probably damaging	Het
Gm14548	A	G	7: 3,897,616	V45A	probably damaging	Het
Gm7298	A	T	6: 121,761,587	I376F	probably damaging	Het
Gpr35	A	C	1: 92,982,631	I22L	probably benign	Het
Grin2b	T	G	6: 135,733,476	D1024A	possibly damaging	Het
Hmcn1	T	C	1: 150,663,873	N2956D	probably damaging	Het
Htt	T	C	5: 34,846,006	L1275P	probably damaging	Het
Ibtk	T	C	9: 85,743,691	D2G	probably benign	Het
Il16	T	A	7: 83,646,451	D1170V	probably damaging	Het
Iqgap3	T	A	3: 88,116,910	I1513N	probably damaging	Het
Kiz	T	G	2: 146,950,510		probably null	Het
Krt12	A	T	11: 99,416,013	*488K	probably null	Het
Lap3	A	T	5: 45,496,948	T83S	probably benign	Het
Lars2	T	A	9: 123,431,993	S410T	probably damaging	Het
Limch1	A	G	5: 67,017,658	T518A	probably benign	Het
Lrrc49	A	T	9: 60,615,156	S381T	probably damaging	Het
Lrrk2	A	G	15: 91,734,055	D919G	possibly damaging	Het
Mmp1a	A	T	9: 7,475,318	S363C	probably damaging	Het
Mrps22	A	C	9: 98,601,471		probably null	Het
Mybpc3	T	C	2: 91,134,604	I1066T	probably benign	Het
Myo10	A	T	15: 25,723,925	N215I	probably damaging	Het
Myocd	A	C	11: 65,218,648	L99R	probably damaging	Het
Nadk	T	G	4: 155,589,336	I394S	probably damaging	Het
Nadsyn1	T	C	7: 143,811,215	N251S	probably damaging	Het
Ncapd2	G	A	6: 125,176,670	P694L	probably benign	Het
Olfr1101	G	T	2: 86,988,820	R119S	probably damaging	Het
Olfr1243	T	C	2: 89,527,557	I284M	probably damaging	Het
Olfr317	A	C	11: 58,732,745	L140R	probably damaging	Het
Olfr705	T	A	7: 106,873,868	I126F	probably damaging	Het
Pcdhb13	T	A	18: 37,443,256	I229K	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Phactr3	A	G	2: 178,302,736	N409S	probably damaging	Het
Pik3c2g	C	A	6: 139,629,870	P305Q	probably damaging	Het
Pik3r4	G	A	9: 105,650,584	V379M	probably damaging	Het
Pkd1l2	A	T	8: 117,076,131	C250*	probably null	Het
Pramef17	A	C	4: 143,991,533	S447A	probably benign	Het
Rapgef6	A	C	11: 54,657,365	T792P	possibly damaging	Het
Rexo5	A	G	7: 119,805,191	D170G	probably damaging	Het
Rnf17	G	A	14: 56,512,332		probably null	Het
Sept11	A	G	5: 93,156,866	I181V	probably benign	Het
Serpina1e	T	G	12: 103,947,018	*414C	probably null	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3bp2	A	G	5: 34,561,631	N560S	probably benign	Het
Slc25a25	A	G	2: 32,419,166	F221S	probably damaging	Het
Spag17	G	T	3: 100,027,401		probably null	Het
Sspn	T	C	6: 145,961,155	L104P	probably damaging	Het
St18	A	C	1: 6,833,594	E693A	probably damaging	Het
St6galnac3	T	C	3: 153,411,532	I185V	possibly damaging	Het
St8sia1	T	C	6: 142,876,669	D156G	probably damaging	Het
Syne2	C	A	12: 76,005,378	S4092R	probably benign	Het
Tll1	T	A	8: 64,124,945	D76V	possibly damaging	Het
Tmco1	C	T	1: 167,308,453		probably benign	Het
Tnfaip3	T	A	10: 19,007,281	T179S	probably benign	Het
Trav16	T	C	14: 53,743,639	I95T	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Unc79	A	G	12: 103,142,626	M2166V	probably benign	Het
Vmn2r1	A	G	3: 64,089,941	I339M	probably damaging	Het
Vwa5b1	A	G	4: 138,605,431		probably null	Het
Washc4	A	T	10: 83,573,774		probably null	Het
Wisp1	T	A	15: 66,913,030	V184E	probably damaging	Het
Wiz	A	G	17: 32,357,628	S642P	possibly damaging	Het
Zeb2	T	A	2: 45,110,041	K60N	possibly damaging	Het
Zfat	T	A	15: 68,178,782	T797S	probably benign	Het
Zfp74	T	C	7: 29,935,165	K373E	probably damaging	Het
Zswim5	T	C	4: 116,975,976		probably null	Het

Other mutations in Nbeal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Nbeal1	APN	1	60235191	nonsense	probably null	0.00
IGL00334:Nbeal1	APN	1	60281883	missense	probably damaging	0.98
IGL00334:Nbeal1	APN	1	60328103	missense	probably damaging	1.00
IGL00514:Nbeal1	APN	1	60217225	missense	probably benign	0.31
IGL00596:Nbeal1	APN	1	60181741	missense	probably damaging	0.96
IGL00654:Nbeal1	APN	1	60195011	critical splice acceptor site	probably benign	0.00
IGL00757:Nbeal1	APN	1	60195143	missense	possibly damaging	0.82
IGL00771:Nbeal1	APN	1	60235353	missense	probably benign	0.11
IGL01315:Nbeal1	APN	1	60281341	missense	probably damaging	1.00
IGL01445:Nbeal1	APN	1	60242625	critical splice donor site	probably null
IGL01456:Nbeal1	APN	1	60230628	missense	probably damaging	1.00
IGL01458:Nbeal1	APN	1	60242625	critical splice donor site	probably null
IGL01535:Nbeal1	APN	1	60217255	missense	probably damaging	1.00
IGL01608:Nbeal1	APN	1	60242535	critical splice acceptor site	probably benign	0.00
IGL02006:Nbeal1	APN	1	60272259	critical splice donor site	probably null
IGL02105:Nbeal1	APN	1	60253501	missense	probably damaging	1.00
IGL02409:Nbeal1	APN	1	60329335	missense	probably benign	0.01
IGL02713:Nbeal1	APN	1	60235237	missense	possibly damaging	0.94
IGL02720:Nbeal1	APN	1	60283987	missense	probably damaging	0.98
IGL02887:Nbeal1	APN	1	60287444	splice site	probably benign
IGL02945:Nbeal1	APN	1	60206410	missense	probably damaging	1.00
IGL03023:Nbeal1	APN	1	60253413	missense	probably damaging	0.98
IGL03114:Nbeal1	APN	1	60278727	missense	probably damaging	1.00
IGL03231:Nbeal1	APN	1	60236459	missense	probably benign	0.44
IGL03241:Nbeal1	APN	1	60234868	missense	possibly damaging	0.46
IGL03241:Nbeal1	APN	1	60234869	missense	probably benign	0.44
IGL03382:Nbeal1	APN	1	60261586	critical splice donor site	probably null
IGL03412:Nbeal1	APN	1	60242567	nonsense	probably null
coach	UTSW	1	60253481	nonsense	probably null
Committee	UTSW	1	60292903	missense	probably damaging	1.00
Disgrace	UTSW	1	60281310	nonsense	probably null
Dravrah	UTSW	1	60284092	missense	probably damaging	1.00
Harvard	UTSW	1	60235563	splice site	probably null
horrified	UTSW	1	60244824	missense	probably damaging	1.00
Lampoon	UTSW	1	60261586	critical splice donor site	probably null
lawyer	UTSW	1	60310224	nonsense	probably null
magistrate	UTSW	1	60194597	critical splice donor site	probably null
Maratimus	UTSW	1	60291888	missense	probably damaging	1.00
National	UTSW	1	60222263	missense	possibly damaging	0.95
phainopepla	UTSW	1	60319687	missense	probably damaging	1.00
R3875_Nbeal1_770	UTSW	1	60194599	splice site	probably benign
satirical	UTSW	1	60235562	critical splice donor site	probably null
silky	UTSW	1	60330878	splice site	probably benign
stiggs	UTSW	1	60237151	missense	probably benign	0.11
3-1:Nbeal1	UTSW	1	60264272	splice site	probably benign
P0007:Nbeal1	UTSW	1	60319688	missense	probably damaging	0.98
P0028:Nbeal1	UTSW	1	60291937	missense	probably damaging	1.00
R0041:Nbeal1	UTSW	1	60281871	missense	probably benign	0.05
R0051:Nbeal1	UTSW	1	60310263	missense	probably benign	0.19
R0052:Nbeal1	UTSW	1	60228612	splice site	probably benign
R0054:Nbeal1	UTSW	1	60287401	utr 3 prime	probably benign
R0062:Nbeal1	UTSW	1	60247717	missense	probably benign	0.01
R0062:Nbeal1	UTSW	1	60247717	missense	probably benign	0.01
R0094:Nbeal1	UTSW	1	60305309	missense	possibly damaging	0.62
R0310:Nbeal1	UTSW	1	60305370	splice site	probably benign
R0324:Nbeal1	UTSW	1	60292873	missense	probably damaging	1.00
R0329:Nbeal1	UTSW	1	60268063	missense	probably damaging	1.00
R0330:Nbeal1	UTSW	1	60268063	missense	probably damaging	1.00
R0417:Nbeal1	UTSW	1	60247734	missense	probably benign	0.00
R0421:Nbeal1	UTSW	1	60268439	missense	probably benign	0.08
R0617:Nbeal1	UTSW	1	60281832	nonsense	probably null
R1034:Nbeal1	UTSW	1	60290006	nonsense	probably null
R1082:Nbeal1	UTSW	1	60312226	missense	probably damaging	0.99
R1123:Nbeal1	UTSW	1	60260269	missense	probably benign
R1187:Nbeal1	UTSW	1	60194528	missense	probably damaging	1.00
R1484:Nbeal1	UTSW	1	60200939	missense	probably damaging	1.00
R1594:Nbeal1	UTSW	1	60305291	missense	possibly damaging	0.91
R1651:Nbeal1	UTSW	1	60200119	missense	probably damaging	1.00
R1678:Nbeal1	UTSW	1	60260334	missense	probably benign	0.00
R1806:Nbeal1	UTSW	1	60284092	missense	probably damaging	1.00
R1937:Nbeal1	UTSW	1	60267941	nonsense	probably null
R1952:Nbeal1	UTSW	1	60234840	missense	probably damaging	1.00
R1953:Nbeal1	UTSW	1	60234840	missense	probably damaging	1.00
R2038:Nbeal1	UTSW	1	60206344	missense	probably benign	0.00
R2044:Nbeal1	UTSW	1	60319687	missense	probably damaging	1.00
R2050:Nbeal1	UTSW	1	60292964	splice site	probably null
R2055:Nbeal1	UTSW	1	60311057	missense	probably damaging	1.00
R2064:Nbeal1	UTSW	1	60270356	missense	possibly damaging	0.89
R2100:Nbeal1	UTSW	1	60305271	splice site	probably null
R2181:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R2192:Nbeal1	UTSW	1	60281895	missense	probably damaging	1.00
R2203:Nbeal1	UTSW	1	60284006	missense	probably benign	0.21
R2267:Nbeal1	UTSW	1	60330878	splice site	probably benign
R2268:Nbeal1	UTSW	1	60330878	splice site	probably benign
R2351:Nbeal1	UTSW	1	60237098	missense	possibly damaging	0.90
R2366:Nbeal1	UTSW	1	60251352	missense	probably damaging	0.97
R2393:Nbeal1	UTSW	1	60251370	missense	probably damaging	0.98
R3545:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3546:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3547:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3701:Nbeal1	UTSW	1	60251413	splice site	probably benign
R3747:Nbeal1	UTSW	1	60195023	missense	probably damaging	0.98
R3875:Nbeal1	UTSW	1	60194599	splice site	probably benign
R4119:Nbeal1	UTSW	1	60291870	missense	probably damaging	0.99
R4256:Nbeal1	UTSW	1	60330948	missense	probably benign	0.19
R4371:Nbeal1	UTSW	1	60289946	missense	possibly damaging	0.95
R4450:Nbeal1	UTSW	1	60267774	missense	probably damaging	0.97
R4558:Nbeal1	UTSW	1	60281310	nonsense	probably null
R4618:Nbeal1	UTSW	1	60228731	intron	probably benign
R4673:Nbeal1	UTSW	1	60329390	missense	probably damaging	1.00
R4719:Nbeal1	UTSW	1	60235563	splice site	probably null
R4798:Nbeal1	UTSW	1	60222193	splice site	probably null
R4826:Nbeal1	UTSW	1	60251342	missense	possibly damaging	0.79
R4841:Nbeal1	UTSW	1	60253375	missense	probably damaging	1.00
R4842:Nbeal1	UTSW	1	60253375	missense	probably damaging	1.00
R4895:Nbeal1	UTSW	1	60292903	missense	probably damaging	1.00
R4929:Nbeal1	UTSW	1	60238654	missense	probably damaging	1.00
R5026:Nbeal1	UTSW	1	60237179	missense	probably damaging	1.00
R5243:Nbeal1	UTSW	1	60270328	missense	probably damaging	0.99
R5300:Nbeal1	UTSW	1	60235559	nonsense	probably null
R5345:Nbeal1	UTSW	1	60328210	critical splice donor site	probably null
R5502:Nbeal1	UTSW	1	60310999	missense	probably damaging	1.00
R5542:Nbeal1	UTSW	1	60277194	missense	probably benign	0.00
R5555:Nbeal1	UTSW	1	60237152	missense	possibly damaging	0.93
R5580:Nbeal1	UTSW	1	60242602	missense	probably benign	0.45
R5765:Nbeal1	UTSW	1	60291847	missense	probably damaging	1.00
R5802:Nbeal1	UTSW	1	60272221	missense	probably benign	0.01
R5907:Nbeal1	UTSW	1	60228791	intron	probably benign
R5918:Nbeal1	UTSW	1	60267892	missense	possibly damaging	0.90
R5923:Nbeal1	UTSW	1	60248395	missense	probably damaging	1.00
R6066:Nbeal1	UTSW	1	60248405	missense	probably benign	0.29
R6091:Nbeal1	UTSW	1	60181556	start gained	probably benign
R6113:Nbeal1	UTSW	1	60222263	missense	possibly damaging	0.95
R6143:Nbeal1	UTSW	1	60251307	missense	possibly damaging	0.81
R6194:Nbeal1	UTSW	1	60257484	missense	possibly damaging	0.80
R6197:Nbeal1	UTSW	1	60222128	missense	probably damaging	0.99
R6228:Nbeal1	UTSW	1	60295924	missense	probably benign	0.00
R6229:Nbeal1	UTSW	1	60248365	missense	possibly damaging	0.88
R6309:Nbeal1	UTSW	1	60238719	missense	probably benign
R6457:Nbeal1	UTSW	1	60253474	missense	probably benign	0.31
R6489:Nbeal1	UTSW	1	60330942	missense	possibly damaging	0.89
R6845:Nbeal1	UTSW	1	60281310	nonsense	probably null
R7021:Nbeal1	UTSW	1	60261586	critical splice donor site	probably null
R7033:Nbeal1	UTSW	1	60310947	missense	probably damaging	1.00
R7145:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7146:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7157:Nbeal1	UTSW	1	60237158	missense	probably damaging	1.00
R7157:Nbeal1	UTSW	1	60260634	nonsense	probably null
R7209:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7210:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7211:Nbeal1	UTSW	1	60200951	missense	probably damaging	1.00
R7212:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7213:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7214:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7283:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7285:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7287:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7296:Nbeal1	UTSW	1	60310224	nonsense	probably null
R7312:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7313:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7329:Nbeal1	UTSW	1	60217196	missense	probably benign	0.39
R7380:Nbeal1	UTSW	1	60244810	missense	probably damaging	1.00
R7414:Nbeal1	UTSW	1	60194597	critical splice donor site	probably null
R7477:Nbeal1	UTSW	1	60261584	missense	probably benign
R7507:Nbeal1	UTSW	1	60235467	missense	probably damaging	1.00
R7642:Nbeal1	UTSW	1	60277227	missense	probably benign	0.31
R7678:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7689:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7728:Nbeal1	UTSW	1	60244824	missense	probably damaging	1.00
R7757:Nbeal1	UTSW	1	60257450	missense	probably damaging	0.97
R7761:Nbeal1	UTSW	1	60319341	missense	probably benign	0.00
R7813:Nbeal1	UTSW	1	60291889	missense	probably damaging	1.00
R7829:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7891:Nbeal1	UTSW	1	60260432	missense	probably benign
R7902:Nbeal1	UTSW	1	60291870	missense	probably damaging	0.99
R8022:Nbeal1	UTSW	1	60260272	nonsense	probably null
R8053:Nbeal1	UTSW	1	60279795	missense	probably damaging	0.98
R8169:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8170:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8178:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8182:Nbeal1	UTSW	1	60200133	missense	probably benign	0.00
R8186:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8187:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8193:Nbeal1	UTSW	1	60253481	nonsense	probably null
R8209:Nbeal1	UTSW	1	60277177	missense	probably damaging	0.99
R8226:Nbeal1	UTSW	1	60277177	missense	probably damaging	0.99
R8549:Nbeal1	UTSW	1	60235562	critical splice donor site	probably null
R8560:Nbeal1	UTSW	1	60235157	missense	probably benign	0.38
R8753:Nbeal1	UTSW	1	60268383	missense	probably damaging	1.00
R8769:Nbeal1	UTSW	1	60235211	missense	probably damaging	0.99
R8771:Nbeal1	UTSW	1	60261584	missense	probably benign
R8952:Nbeal1	UTSW	1	60260300	missense	probably benign	0.01
R9014:Nbeal1	UTSW	1	60289959	missense	probably damaging	1.00
R9056:Nbeal1	UTSW	1	60278726	missense	probably damaging	1.00
R9091:Nbeal1	UTSW	1	60268389	missense	possibly damaging	0.50
R9138:Nbeal1	UTSW	1	60247745	nonsense	probably null
R9168:Nbeal1	UTSW	1	60291888	missense	probably damaging	1.00
R9200:Nbeal1	UTSW	1	60281266	missense	probably damaging	1.00
R9205:Nbeal1	UTSW	1	60278680	missense	probably damaging	1.00
R9270:Nbeal1	UTSW	1	60268389	missense	possibly damaging	0.50
R9322:Nbeal1	UTSW	1	60258659	missense	possibly damaging	0.91
R9405:Nbeal1	UTSW	1	60310265	missense	probably damaging	1.00
R9554:Nbeal1	UTSW	1	60251128	nonsense	probably null
R9557:Nbeal1	UTSW	1	60235350	missense	probably benign
R9560:Nbeal1	UTSW	1	60329385	missense	probably damaging	1.00
R9641:Nbeal1	UTSW	1	60311088	missense	probably damaging	1.00
R9784:Nbeal1	UTSW	1	60260582	nonsense	probably null
X0022:Nbeal1	UTSW	1	60277232	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- GTCTTTGGCTTTGCTGAACC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'

Posted On

2019-05-15