Incidental Mutation 'R7144:Adcy10'
ID 553597
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 045328-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 165510370 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 184 (M184I)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: M184I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: M184I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: M184I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: M184I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
Bugged UTSW 1 165564237 missense probably damaging 0.99
debye UTSW 1 165551361 critical splice donor site probably null
malaysian UTSW 1 165513127 missense probably benign 0.38
singaporean UTSW 1 165518312 missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7182:Adcy10 UTSW 1 165543470 splice site probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165546549 missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165503288 missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165510337 missense probably benign 0.34
R8812:Adcy10 UTSW 1 165551298 missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165518345 missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165575649 missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165543110 missense probably benign 0.00
R9712:Adcy10 UTSW 1 165513112 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTTAGAGGTTGTGTAGCCAC -3'
(R):5'- TTCTTTCTTGGGCTCAGCAG -3'

Sequencing Primer
(F):5'- GTAGCCACATCTGATTTTTCCAAGAC -3'
(R):5'- CTGGCTCCTCCCACAGG -3'
Posted On 2019-05-15