Incidental Mutation 'R7144:Adcy10'
ID 553597
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 045328-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 165337939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 184 (M184I)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: M184I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: M184I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: M184I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: M184I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: M184I

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,032,796 (GRCm39) I272F possibly damaging Het
Aldoa G T 7: 126,396,034 (GRCm39) T124N possibly damaging Het
Ap4e1 T A 2: 126,853,727 (GRCm39) I55N probably damaging Het
Arhgap21 T C 2: 20,870,198 (GRCm39) T913A probably benign Het
Atrnl1 G A 19: 58,030,784 (GRCm39) E1309K probably damaging Het
BC034090 A T 1: 155,117,777 (GRCm39) C114S probably damaging Het
Brinp2 A G 1: 158,122,994 (GRCm39) probably null Het
Ccn4 T A 15: 66,784,879 (GRCm39) V184E probably damaging Het
Ccna1 G T 3: 54,953,120 (GRCm39) H408Q probably benign Het
Cd209g T G 8: 4,185,189 (GRCm39) probably benign Het
Cdc20b A G 13: 113,219,905 (GRCm39) I433V probably benign Het
Cdk2ap1 G A 5: 124,492,421 (GRCm39) P5L probably damaging Het
Cep128 T C 12: 91,260,933 (GRCm39) E310G probably damaging Het
Cflar G T 1: 58,793,007 (GRCm39) V458F Het
Clec4b2 A G 6: 123,158,343 (GRCm39) T70A probably benign Het
Cntnap5c A G 17: 58,593,883 (GRCm39) T741A probably benign Het
Csf3r A T 4: 125,937,515 (GRCm39) T800S probably benign Het
Csnk1g2 T C 10: 80,473,733 (GRCm39) Y67H probably damaging Het
Cyp2c67 A T 19: 39,604,138 (GRCm39) V406E probably benign Het
Dnah10 A G 5: 124,900,006 (GRCm39) D3868G probably damaging Het
Dnah7a A T 1: 53,737,867 (GRCm39) probably null Het
Dst A G 1: 34,191,324 (GRCm39) N208S probably damaging Het
Echdc3 A G 2: 6,211,224 (GRCm39) probably null Het
Edrf1 T C 7: 133,239,578 (GRCm39) S13P probably benign Het
Ephb1 T C 9: 101,841,276 (GRCm39) Y734C probably damaging Het
Eps8l1 A G 7: 4,475,184 (GRCm39) Y325C probably damaging Het
Evc2 A G 5: 37,544,183 (GRCm39) D644G probably damaging Het
Eya4 A C 10: 23,048,943 (GRCm39) D54E probably benign Het
Filip1 T C 9: 79,727,495 (GRCm39) S375G possibly damaging Het
Fmo9 A G 1: 166,505,189 (GRCm39) M68T probably benign Het
Gemin5 G C 11: 58,032,489 (GRCm39) P772A probably benign Het
Gle1 T G 2: 29,833,805 (GRCm39) C401G probably damaging Het
Gm7298 A T 6: 121,738,546 (GRCm39) I376F probably damaging Het
Gpr35 A C 1: 92,910,353 (GRCm39) I22L probably benign Het
Grin2b T G 6: 135,710,474 (GRCm39) D1024A possibly damaging Het
Hmcn1 T C 1: 150,539,624 (GRCm39) N2956D probably damaging Het
Htt T C 5: 35,003,350 (GRCm39) L1275P probably damaging Het
Ibtk T C 9: 85,625,744 (GRCm39) D2G probably benign Het
Il16 T A 7: 83,295,659 (GRCm39) D1170V probably damaging Het
Iqgap3 T A 3: 88,024,217 (GRCm39) I1513N probably damaging Het
Kiz T G 2: 146,792,430 (GRCm39) probably null Het
Krt12 A T 11: 99,306,839 (GRCm39) *488K probably null Het
Lap3 A T 5: 45,654,290 (GRCm39) T83S probably benign Het
Lars2 T A 9: 123,261,058 (GRCm39) S410T probably damaging Het
Limch1 A G 5: 67,175,001 (GRCm39) T518A probably benign Het
Lrrc49 A T 9: 60,522,439 (GRCm39) S381T probably damaging Het
Lrrk2 A G 15: 91,618,258 (GRCm39) D919G possibly damaging Het
Mmp1a A T 9: 7,475,319 (GRCm39) S363C probably damaging Het
Mrps22 A C 9: 98,483,524 (GRCm39) probably null Het
Mybpc3 T C 2: 90,964,949 (GRCm39) I1066T probably benign Het
Myo10 A T 15: 25,724,011 (GRCm39) N215I probably damaging Het
Myocd A C 11: 65,109,474 (GRCm39) L99R probably damaging Het
Nadk T G 4: 155,673,793 (GRCm39) I394S probably damaging Het
Nadsyn1 T C 7: 143,364,952 (GRCm39) N251S probably damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Ncapd2 G A 6: 125,153,633 (GRCm39) P694L probably benign Het
Or2ag1 T A 7: 106,473,075 (GRCm39) I126F probably damaging Het
Or2w3b A C 11: 58,623,571 (GRCm39) L140R probably damaging Het
Or4a71 T C 2: 89,357,901 (GRCm39) I284M probably damaging Het
Or5t16 G T 2: 86,819,164 (GRCm39) R119S probably damaging Het
Pcdhb13 T A 18: 37,576,309 (GRCm39) I229K probably damaging Het
Pgbd5 A T 8: 125,101,056 (GRCm39) M400K possibly damaging Het
Phactr3 A G 2: 177,944,529 (GRCm39) N409S probably damaging Het
Pik3c2g C A 6: 139,606,868 (GRCm39) P305Q probably damaging Het
Pik3r4 G A 9: 105,527,783 (GRCm39) V379M probably damaging Het
Pira12 A G 7: 3,900,615 (GRCm39) V45A probably damaging Het
Pkd1l2 A T 8: 117,802,870 (GRCm39) C250* probably null Het
Pramel14 A C 4: 143,718,103 (GRCm39) S447A probably benign Het
Rapgef6 A C 11: 54,548,191 (GRCm39) T792P possibly damaging Het
Rexo5 A G 7: 119,404,414 (GRCm39) D170G probably damaging Het
Rnf17 G A 14: 56,749,789 (GRCm39) probably null Het
Septin11 A G 5: 93,304,725 (GRCm39) I181V probably benign Het
Serpina1e T G 12: 103,913,277 (GRCm39) *414C probably null Het
Serpine1 C A 5: 137,099,918 (GRCm39) Q80H probably damaging Het
Sh3bp2 A G 5: 34,718,975 (GRCm39) N560S probably benign Het
Slc25a25 A G 2: 32,309,178 (GRCm39) F221S probably damaging Het
Spag17 G T 3: 99,934,717 (GRCm39) probably null Het
Sspn T C 6: 145,906,881 (GRCm39) L104P probably damaging Het
St18 A C 1: 6,903,818 (GRCm39) E693A probably damaging Het
St6galnac3 T C 3: 153,117,169 (GRCm39) I185V possibly damaging Het
St8sia1 T C 6: 142,822,395 (GRCm39) D156G probably damaging Het
Syne2 C A 12: 76,052,152 (GRCm39) S4092R probably benign Het
Tll1 T A 8: 64,577,979 (GRCm39) D76V possibly damaging Het
Tmco1 C T 1: 167,136,022 (GRCm39) probably benign Het
Tnfaip3 T A 10: 18,883,029 (GRCm39) T179S probably benign Het
Trav16 T C 14: 53,981,096 (GRCm39) I95T possibly damaging Het
Trip12 A T 1: 84,771,435 (GRCm39) S280T probably damaging Het
Unc79 A G 12: 103,108,885 (GRCm39) M2166V probably benign Het
Vmn2r1 A G 3: 63,997,362 (GRCm39) I339M probably damaging Het
Vwa5b1 A G 4: 138,332,742 (GRCm39) probably null Het
Washc4 A T 10: 83,409,638 (GRCm39) probably null Het
Wiz A G 17: 32,576,602 (GRCm39) S642P possibly damaging Het
Zeb2 T A 2: 45,000,053 (GRCm39) K60N possibly damaging Het
Zfat T A 15: 68,050,631 (GRCm39) T797S probably benign Het
Zfp74 T C 7: 29,634,590 (GRCm39) K373E probably damaging Het
Zswim5 T C 4: 116,833,173 (GRCm39) probably null Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTTAGAGGTTGTGTAGCCAC -3'
(R):5'- TTCTTTCTTGGGCTCAGCAG -3'

Sequencing Primer
(F):5'- GTAGCCACATCTGATTTTTCCAAGAC -3'
(R):5'- CTGGCTCCTCCCACAGG -3'
Posted On 2019-05-15