Mutagenetix > Incidental Mutations

Incidental Mutation 'R7144:Arhgap21'

553601

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R7144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20847919-20968881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20865387 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 913 (T913A)

Ref Sequence

ENSEMBL: ENSMUSP00000122497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000173784] [ENSMUST00000174584]

Predicted Effect

probably benign
Transcript: ENSMUST00000114594
AA Change: T907A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: T907A

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298
AA Change: T913A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: T913A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230
AA Change: T913A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: T913A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173194
AA Change: T903A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: T903A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173784
AA Change: T17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133539
Gene: ENSMUSG00000036591
AA Change: T17A

Domain	Start	End	E-Value	Type
low complexity region	21	35	N/A	INTRINSIC
PH	40	150	2.09e-16	SMART
RhoGAP	268	395	1.55e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: T742A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: T742A

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,433,573	I272F	possibly damaging	Het
Adcy10	G	T	1: 165,510,370	M184I	probably benign	Het
Aldoa	G	T	7: 126,796,862	T124N	possibly damaging	Het
Ap4e1	T	A	2: 127,011,807	I55N	probably damaging	Het
Atrnl1	G	A	19: 58,042,352	E1309K	probably damaging	Het
BC034090	A	T	1: 155,242,031	C114S	probably damaging	Het
Brinp2	A	G	1: 158,295,424		probably null	Het
Ccna1	G	T	3: 55,045,699	H408Q	probably benign	Het
Cd209g	T	G	8: 4,135,189		probably benign	Het
Cdc20b	A	G	13: 113,083,371	I433V	probably benign	Het
Cdk2ap1	G	A	5: 124,354,358	P5L	probably damaging	Het
Cep128	T	C	12: 91,294,159	E310G	probably damaging	Het
Cflar	G	T	1: 58,753,848	V458F		Het
Clec4b2	A	G	6: 123,181,384	T70A	probably benign	Het
Cntnap5c	A	G	17: 58,286,888	T741A	probably benign	Het
Csf3r	A	T	4: 126,043,722	T800S	probably benign	Het
Csnk1g2	T	C	10: 80,637,899	Y67H	probably damaging	Het
Cyp2c67	A	T	19: 39,615,694	V406E	probably benign	Het
Dnah10	A	G	5: 124,822,942	D3868G	probably damaging	Het
Dnah7a	A	T	1: 53,698,708		probably null	Het
Dst	A	G	1: 34,152,243	N208S	probably damaging	Het
Echdc3	A	G	2: 6,206,413		probably null	Het
Edrf1	T	C	7: 133,637,849	S13P	probably benign	Het
Ephb1	T	C	9: 101,964,077	Y734C	probably damaging	Het
Eps8l1	A	G	7: 4,472,185	Y325C	probably damaging	Het
Evc2	A	G	5: 37,386,839	D644G	probably damaging	Het
Eya4	A	C	10: 23,173,045	D54E	probably benign	Het
Filip1	T	C	9: 79,820,213	S375G	possibly damaging	Het
Fmo9	A	G	1: 166,677,620	M68T	probably benign	Het
Gemin5	G	C	11: 58,141,663	P772A	probably benign	Het
Gle1	T	G	2: 29,943,793	C401G	probably damaging	Het
Gm14548	A	G	7: 3,897,616	V45A	probably damaging	Het
Gm7298	A	T	6: 121,761,587	I376F	probably damaging	Het
Gpr35	A	C	1: 92,982,631	I22L	probably benign	Het
Grin2b	T	G	6: 135,733,476	D1024A	possibly damaging	Het
Hmcn1	T	C	1: 150,663,873	N2956D	probably damaging	Het
Htt	T	C	5: 34,846,006	L1275P	probably damaging	Het
Ibtk	T	C	9: 85,743,691	D2G	probably benign	Het
Il16	T	A	7: 83,646,451	D1170V	probably damaging	Het
Iqgap3	T	A	3: 88,116,910	I1513N	probably damaging	Het
Kiz	T	G	2: 146,950,510		probably null	Het
Krt12	A	T	11: 99,416,013	*488K	probably null	Het
Lap3	A	T	5: 45,496,948	T83S	probably benign	Het
Lars2	T	A	9: 123,431,993	S410T	probably damaging	Het
Limch1	A	G	5: 67,017,658	T518A	probably benign	Het
Lrrc49	A	T	9: 60,615,156	S381T	probably damaging	Het
Lrrk2	A	G	15: 91,734,055	D919G	possibly damaging	Het
Mmp1a	A	T	9: 7,475,318	S363C	probably damaging	Het
Mrps22	A	C	9: 98,601,471		probably null	Het
Mybpc3	T	C	2: 91,134,604	I1066T	probably benign	Het
Myo10	A	T	15: 25,723,925	N215I	probably damaging	Het
Myocd	A	C	11: 65,218,648	L99R	probably damaging	Het
Nadk	T	G	4: 155,589,336	I394S	probably damaging	Het
Nadsyn1	T	C	7: 143,811,215	N251S	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Ncapd2	G	A	6: 125,176,670	P694L	probably benign	Het
Olfr1101	G	T	2: 86,988,820	R119S	probably damaging	Het
Olfr1243	T	C	2: 89,527,557	I284M	probably damaging	Het
Olfr317	A	C	11: 58,732,745	L140R	probably damaging	Het
Olfr705	T	A	7: 106,873,868	I126F	probably damaging	Het
Pcdhb13	T	A	18: 37,443,256	I229K	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Phactr3	A	G	2: 178,302,736	N409S	probably damaging	Het
Pik3c2g	C	A	6: 139,629,870	P305Q	probably damaging	Het
Pik3r4	G	A	9: 105,650,584	V379M	probably damaging	Het
Pkd1l2	A	T	8: 117,076,131	C250*	probably null	Het
Pramef17	A	C	4: 143,991,533	S447A	probably benign	Het
Rapgef6	A	C	11: 54,657,365	T792P	possibly damaging	Het
Rexo5	A	G	7: 119,805,191	D170G	probably damaging	Het
Rnf17	G	A	14: 56,512,332		probably null	Het
Sept11	A	G	5: 93,156,866	I181V	probably benign	Het
Serpina1e	T	G	12: 103,947,018	*414C	probably null	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3bp2	A	G	5: 34,561,631	N560S	probably benign	Het
Slc25a25	A	G	2: 32,419,166	F221S	probably damaging	Het
Spag17	G	T	3: 100,027,401		probably null	Het
Sspn	T	C	6: 145,961,155	L104P	probably damaging	Het
St18	A	C	1: 6,833,594	E693A	probably damaging	Het
St6galnac3	T	C	3: 153,411,532	I185V	possibly damaging	Het
St8sia1	T	C	6: 142,876,669	D156G	probably damaging	Het
Syne2	C	A	12: 76,005,378	S4092R	probably benign	Het
Tll1	T	A	8: 64,124,945	D76V	possibly damaging	Het
Tmco1	C	T	1: 167,308,453		probably benign	Het
Tnfaip3	T	A	10: 19,007,281	T179S	probably benign	Het
Trav16	T	C	14: 53,743,639	I95T	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Unc79	A	G	12: 103,142,626	M2166V	probably benign	Het
Vmn2r1	A	G	3: 64,089,941	I339M	probably damaging	Het
Vwa5b1	A	G	4: 138,605,431		probably null	Het
Washc4	A	T	10: 83,573,774		probably null	Het
Wisp1	T	A	15: 66,913,030	V184E	probably damaging	Het
Wiz	A	G	17: 32,357,628	S642P	possibly damaging	Het
Zeb2	T	A	2: 45,110,041	K60N	possibly damaging	Het
Zfat	T	A	15: 68,178,782	T797S	probably benign	Het
Zfp74	T	C	7: 29,935,165	K373E	probably damaging	Het
Zswim5	T	C	4: 116,975,976		probably null	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20855700	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20849581	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20914644	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20849637	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20880002	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20880306	missense	probably benign
IGL02264:Arhgap21	APN	2	20860039	splice site	probably null
IGL02346:Arhgap21	APN	2	20879951	splice site	probably benign
IGL02418:Arhgap21	APN	2	20880900	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20855588	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20892091	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20861063	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20914721	missense	probably benign
IGL03265:Arhgap21	APN	2	20849628	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20880689	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20859801	splice site	probably benign
R0363:Arhgap21	UTSW	2	20881133	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20863117	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20914799	nonsense	probably null
R0633:Arhgap21	UTSW	2	20855387	nonsense	probably null
R0905:Arhgap21	UTSW	2	20849934	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20881765	nonsense	probably null
R1570:Arhgap21	UTSW	2	20880840	missense	probably benign
R1686:Arhgap21	UTSW	2	20881848	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20861099	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20849520	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20881640	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20880051	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20854998	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20850291	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20859906	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20892104	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20967335	missense	probably benign
R4686:Arhgap21	UTSW	2	20863222	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20850156	missense	probably benign
R4834:Arhgap21	UTSW	2	20865319	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20881187	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20880468	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20850061	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20858989	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20849890	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20880037	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20848834	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20849316	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20849722	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20881086	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20880686	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20863213	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20849041	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20881376	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20881805	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20880732	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20880296	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20848848	missense	probably benign
R6844:Arhgap21	UTSW	2	20881305	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20880510	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20850331	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20848878	missense	possibly damaging	0.65
R7237:Arhgap21	UTSW	2	20849972	nonsense	probably null
R7261:Arhgap21	UTSW	2	20880366	missense	probably benign
R7558:Arhgap21	UTSW	2	20855610	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20912291	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20849479	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20850358	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20863172	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20880713	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20849196	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20863156	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20880405	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20849410	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTATGAGCTTCGCTTATTAGGCC -3'
(R):5'- GCTTTTGAAAACCAAATGGAAGCC -3'

Sequencing Primer
(F):5'- GCCTGAATTTCTGATGTCACACGAG -3'
(R):5'- TTGCCAACACCATTTCCA -3'

Posted On

2019-05-15