Incidental Mutation 'R7144:Slc25a25'
ID 553603
Institutional Source Beutler Lab
Gene Symbol Slc25a25
Ensembl Gene ENSMUSG00000026819
Gene Name solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms 1110030N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32414487-32451445 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32419166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 221 (F221S)
Ref Sequence ENSEMBL: ENSMUSP00000028160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]
AlphaFold A2ASZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000028160
AA Change: F221S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819
AA Change: F221S

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
Blast:EFh 151 191 1e-9 BLAST
Pfam:Mito_carr 227 320 1.7e-26 PFAM
Pfam:Mito_carr 321 413 6.4e-26 PFAM
Pfam:Mito_carr 418 512 9.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000052119
AA Change: F208S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819
AA Change: F208S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
Blast:EFh 138 178 2e-9 BLAST
Pfam:Mito_carr 214 307 1.2e-26 PFAM
Pfam:Mito_carr 308 400 2.5e-27 PFAM
Pfam:Mito_carr 405 500 4.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113307
AA Change: F176S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819
AA Change: F176S

DomainStartEndE-ValueType
EFh 51 79 9.51e0 SMART
EFh 82 110 1.36e0 SMART
EFh 118 146 8.82e1 SMART
Pfam:Mito_carr 182 275 1.1e-26 PFAM
Pfam:Mito_carr 276 368 2.2e-27 PFAM
Pfam:Mito_carr 373 468 4.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113308
AA Change: F196S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819
AA Change: F196S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
EFh 138 166 8.82e1 SMART
Pfam:Mito_carr 202 295 1.1e-26 PFAM
Pfam:Mito_carr 296 388 2.4e-27 PFAM
Pfam:Mito_carr 393 488 4.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113310
AA Change: F209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819
AA Change: F209S

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
EFh 151 179 8.82e1 SMART
Pfam:Mito_carr 215 308 1.2e-26 PFAM
Pfam:Mito_carr 309 401 2.5e-27 PFAM
Pfam:Mito_carr 406 501 4.9e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819
AA Change: F172S

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
Blast:EFh 103 143 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136361
AA Change: F161S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819
AA Change: F161S

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
EFh 103 131 8.82e1 SMART
Pfam:Mito_carr 167 260 9.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153886
AA Change: F73S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819
AA Change: F73S

DomainStartEndE-ValueType
SCOP:d1exra_ 1 38 1e-4 SMART
Blast:EFh 15 43 2e-13 BLAST
Pfam:Mito_carr 79 112 1.1e-7 PFAM
Meta Mutation Damage Score 0.8829 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Slc25a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Slc25a25 APN 2 32419160 missense probably benign 0.04
IGL01431:Slc25a25 APN 2 32419091 missense probably damaging 1.00
IGL02211:Slc25a25 APN 2 32417440 missense probably damaging 1.00
IGL02393:Slc25a25 APN 2 32417843 missense probably benign 0.40
R0385:Slc25a25 UTSW 2 32417822 missense probably damaging 0.99
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1611:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
R1960:Slc25a25 UTSW 2 32420651 splice site probably null
R2405:Slc25a25 UTSW 2 32417719 splice site probably null
R3749:Slc25a25 UTSW 2 32420380 missense probably benign 0.21
R4446:Slc25a25 UTSW 2 32430609 missense probably benign 0.00
R4815:Slc25a25 UTSW 2 32420410 missense probably damaging 1.00
R5245:Slc25a25 UTSW 2 32421328 nonsense probably null
R6884:Slc25a25 UTSW 2 32420662 missense probably benign 0.34
R7210:Slc25a25 UTSW 2 32420396 missense possibly damaging 0.89
R7255:Slc25a25 UTSW 2 32421372 missense possibly damaging 0.60
R7667:Slc25a25 UTSW 2 32451209 missense probably benign 0.00
R7893:Slc25a25 UTSW 2 32451165 nonsense probably null
R8031:Slc25a25 UTSW 2 32421505 missense probably damaging 0.97
R8550:Slc25a25 UTSW 2 32416193 missense probably damaging 1.00
R9076:Slc25a25 UTSW 2 32419163 missense probably damaging 1.00
R9255:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
X0021:Slc25a25 UTSW 2 32421514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGAGCCTCCAATGAAC -3'
(R):5'- AAAGTCCTTGCGGAAAGTTCC -3'

Sequencing Primer
(F):5'- CCACGGGTAAAAATCTGCTCG -3'
(R):5'- GCAACCCAACAGTGTTGTAATG -3'
Posted On 2019-05-15