Incidental Mutation 'R7144:Ap4e1'
ID 553608
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Name adaptor-related protein complex AP-4, epsilon 1
Synonyms 2310033A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127008717-127067909 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127011807 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 55 (I55N)
Ref Sequence ENSEMBL: ENSMUSP00000002063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000110393] [ENSMUST00000110394] [ENSMUST00000175663] [ENSMUST00000177372]
AlphaFold Q80V94
Predicted Effect probably damaging
Transcript: ENSMUST00000002063
AA Change: I55N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: I55N

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110393
Predicted Effect possibly damaging
Transcript: ENSMUST00000110394
AA Change: I55N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106024
Gene: ENSMUSG00000001998
AA Change: I55N

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 392 2.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175663
AA Change: I55N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135599
Gene: ENSMUSG00000001998
AA Change: I55N

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 355 1.3e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177372
AA Change: I55N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998
AA Change: I55N

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 291 2.5e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 127028281 missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 127028289 missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 127063301 missense probably benign 0.30
IGL01155:Ap4e1 APN 2 127043445 missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 127052189 missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 127046910 missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 127043511 missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 127061929 missense probably benign
IGL02207:Ap4e1 APN 2 127011816 missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 127063397 missense probably benign 0.18
quickstep UTSW 2 127008902 critical splice donor site probably null
K7371:Ap4e1 UTSW 2 127066536 unclassified probably benign
R0090:Ap4e1 UTSW 2 127064985 missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 127049360 missense probably damaging 1.00
R0490:Ap4e1 UTSW 2 127046186 missense probably damaging 1.00
R0632:Ap4e1 UTSW 2 127049280 nonsense probably null
R0670:Ap4e1 UTSW 2 127011864 critical splice donor site probably null
R0698:Ap4e1 UTSW 2 127063363 missense probably benign 0.00
R1183:Ap4e1 UTSW 2 127014201 missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 127046909 missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 127061555 missense probably null 1.00
R1528:Ap4e1 UTSW 2 127011823 missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 127061547 missense probably benign 0.00
R2270:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R2271:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R3108:Ap4e1 UTSW 2 127056306 critical splice donor site probably null
R4019:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4020:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4454:Ap4e1 UTSW 2 127047141 missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 127061871 missense probably benign 0.08
R4767:Ap4e1 UTSW 2 127060438 missense probably benign
R4803:Ap4e1 UTSW 2 127049559 missense probably benign 0.20
R4804:Ap4e1 UTSW 2 127043758 critical splice donor site probably null
R5155:Ap4e1 UTSW 2 127063369 missense probably benign 0.02
R5157:Ap4e1 UTSW 2 127061695 missense probably benign 0.00
R5248:Ap4e1 UTSW 2 127064922 missense possibly damaging 0.95
R5363:Ap4e1 UTSW 2 127037864 splice site probably null
R5507:Ap4e1 UTSW 2 127008898 missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 127064979 missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 127028160 splice site probably null
R6180:Ap4e1 UTSW 2 127066588 nonsense probably null
R6298:Ap4e1 UTSW 2 127047115 missense probably benign 0.00
R6329:Ap4e1 UTSW 2 127061716 missense probably benign 0.10
R6543:Ap4e1 UTSW 2 127066605 missense probably benign 0.03
R6954:Ap4e1 UTSW 2 127064951 missense probably benign 0.01
R7165:Ap4e1 UTSW 2 127063318 missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 127061976 missense probably damaging 0.96
R7348:Ap4e1 UTSW 2 127061977 missense possibly damaging 0.76
R7382:Ap4e1 UTSW 2 127008902 critical splice donor site probably null
R7571:Ap4e1 UTSW 2 127019336 missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 127046934 missense probably damaging 1.00
R8875:Ap4e1 UTSW 2 127035180 missense probably damaging 1.00
R9135:Ap4e1 UTSW 2 127019322 missense probably damaging 1.00
X0060:Ap4e1 UTSW 2 127063410 missense probably benign 0.01
X0065:Ap4e1 UTSW 2 127061650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAGGCATCATCTCACTACC -3'
(R):5'- GCAAATAGCCTCACAGTGGC -3'

Sequencing Primer
(F):5'- GAGCCTTCATCCTTTGGAAGAACAG -3'
(R):5'- TCACAGTGGCCAGCAGAG -3'
Posted On 2019-05-15