Incidental Mutation 'R7144:Sept11'
ID 553624
Institutional Source Beutler Lab
Gene Symbol Sept11
Ensembl Gene ENSMUSG00000058013
Gene Name septin 11
Synonyms 6230410I01Rik, D5Ertd606e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 93093437-93176447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93156866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 181 (I181V)
Ref Sequence ENSEMBL: ENSMUSP00000074293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074733] [ENSMUST00000201421] [ENSMUST00000201700] [ENSMUST00000202196] [ENSMUST00000202217] [ENSMUST00000202308]
AlphaFold Q8C1B7
Predicted Effect probably benign
Transcript: ENSMUST00000074733
AA Change: I181V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074293
Gene: ENSMUSG00000058013
AA Change: I181V

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201421
AA Change: I181V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143928
Gene: ENSMUSG00000058013
AA Change: I181V

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201700
AA Change: I181V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143901
Gene: ENSMUSG00000058013
AA Change: I181V

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.9e-99 PFAM
Pfam:MMR_HSR1 43 185 7e-7 PFAM
coiled coil region 333 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202196
AA Change: I124V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144573
Gene: ENSMUSG00000058013
AA Change: I124V

DomainStartEndE-ValueType
Pfam:Septin 1 204 5.9e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202217
AA Change: I181V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144235
Gene: ENSMUSG00000058013
AA Change: I181V

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.7e-101 PFAM
Pfam:MMR_HSR1 43 185 4.1e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202308
AA Change: I181V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144136
Gene: ENSMUSG00000058013
AA Change: I181V

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.1e-101 PFAM
Pfam:MMR_HSR1 43 185 3.7e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Sept11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept11 APN 5 93157018 splice site probably null
IGL00984:Sept11 APN 5 93162184 missense possibly damaging 0.90
IGL01452:Sept11 APN 5 93161204 missense possibly damaging 0.82
IGL01677:Sept11 APN 5 93148533 missense probably damaging 0.98
IGL01732:Sept11 APN 5 93161226 missense probably damaging 1.00
IGL02476:Sept11 APN 5 93148584 critical splice donor site probably null
I0000:Sept11 UTSW 5 93165259 missense probably benign 0.05
R0544:Sept11 UTSW 5 93165368 missense possibly damaging 0.80
R0611:Sept11 UTSW 5 93167534 missense probably damaging 0.99
R1438:Sept11 UTSW 5 93148428 missense probably damaging 1.00
R1702:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R1727:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R3838:Sept11 UTSW 5 93148399 missense probably damaging 1.00
R3847:Sept11 UTSW 5 93162167 missense probably damaging 1.00
R4609:Sept11 UTSW 5 93162254 missense possibly damaging 0.89
R4717:Sept11 UTSW 5 93156956 missense possibly damaging 0.89
R4852:Sept11 UTSW 5 93162253 missense possibly damaging 0.52
R4986:Sept11 UTSW 5 93161241 missense probably damaging 1.00
R5806:Sept11 UTSW 5 93167578 missense probably benign 0.18
R5826:Sept11 UTSW 5 93139450 missense possibly damaging 0.79
R5896:Sept11 UTSW 5 93156965 missense probably damaging 1.00
R6641:Sept11 UTSW 5 93139552 missense probably damaging 1.00
R7479:Sept11 UTSW 5 93156945 missense probably damaging 0.99
R7757:Sept11 UTSW 5 93171464 splice site probably null
R8056:Sept11 UTSW 5 93167576 missense unknown
R8103:Sept11 UTSW 5 93161148 critical splice acceptor site probably null
R9152:Sept11 UTSW 5 93139470 missense probably benign 0.00
R9429:Sept11 UTSW 5 93173538 critical splice donor site probably null
Z1177:Sept11 UTSW 5 93156963 missense probably damaging 0.96
Z1177:Sept11 UTSW 5 93162283 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTGAGAGGATTCTGCATCTG -3'
(R):5'- AATGCTAGCAGGACACAAGC -3'

Sequencing Primer
(F):5'- GCATCTGAATTTATCATCCAGGAGG -3'
(R):5'- CTAGCAGGACACAAGCTTGCTG -3'
Posted On 2019-05-15