Incidental Mutation 'R0601:Capn3'
ID55363
Institutional Source Beutler Lab
Gene Symbol Capn3
Ensembl Gene ENSMUSG00000079110
Gene Namecalpain 3
SynonymsCapa-3, Capa3, Lp82, p94
MMRRC Submission 038790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R0601 (G1)
Quality Score103
Status Validated
Chromosome2
Chromosomal Location120456019-120504913 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 120502596 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028748] [ENSMUST00000028749] [ENSMUST00000055241] [ENSMUST00000090028] [ENSMUST00000090028] [ENSMUST00000110716] [ENSMUST00000110716] [ENSMUST00000110719] [ENSMUST00000110719] [ENSMUST00000110721]
Predicted Effect probably null
Transcript: ENSMUST00000028748
SMART Domains Protein: ENSMUSP00000028748
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
EFh 584 612 5.53e-4 SMART
EFh 614 642 1.8e-3 SMART
EFh 679 707 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028749
SMART Domains Protein: ENSMUSP00000028749
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 56 425 2.09e-212 SMART
calpain_III 428 582 4.27e-90 SMART
Pfam:Calpain_u2 583 653 1.3e-31 PFAM
EFh 696 724 5.53e-4 SMART
EFh 726 754 1.8e-3 SMART
EFh 791 819 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055241
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090028
SMART Domains Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
low complexity region 585 599 N/A INTRINSIC
EFh 612 640 5.53e-4 SMART
EFh 642 670 1.8e-3 SMART
EFh 707 735 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090028
SMART Domains Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
low complexity region 585 599 N/A INTRINSIC
EFh 612 640 5.53e-4 SMART
EFh 642 670 1.8e-3 SMART
EFh 707 735 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110716
SMART Domains Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
EFh 632 660 5.53e-4 SMART
EFh 662 690 1.8e-3 SMART
EFh 727 755 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110716
SMART Domains Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
EFh 632 660 5.53e-4 SMART
EFh 662 690 1.8e-3 SMART
EFh 727 755 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110719
SMART Domains Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
low complexity region 633 647 N/A INTRINSIC
EFh 660 688 5.53e-4 SMART
EFh 690 718 1.8e-3 SMART
EFh 755 783 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110719
SMART Domains Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
low complexity region 633 647 N/A INTRINSIC
EFh 660 688 5.53e-4 SMART
EFh 690 718 1.8e-3 SMART
EFh 755 783 4.32e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110721
SMART Domains Protein: ENSMUSP00000106349
Gene: ENSMUSG00000079110

DomainStartEndE-ValueType
CysPc 56 377 1.13e-208 SMART
calpain_III 380 534 4.27e-90 SMART
EFh 604 632 5.53e-4 SMART
EFh 634 662 1.8e-3 SMART
EFh 699 727 4.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151342
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 98% (119/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in muscle dystrophy. The psoas, soleus, and deltoid muscles are the most severely affected. The mutant allele appears to be preferentially transmitted resulting in ratio distortion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,810,189 D143A probably damaging Het
Abca9 C T 11: 110,117,058 probably null Het
Abcc5 A G 16: 20,404,559 probably benign Het
Ablim3 T A 18: 61,849,370 D168V probably benign Het
Acsl3 C T 1: 78,696,179 S352F probably damaging Het
Adgrl4 A T 3: 151,498,429 probably benign Het
Arhgap29 A G 3: 121,991,110 K229E probably damaging Het
Atad3a A T 4: 155,747,407 V470D probably damaging Het
Atp8b1 A G 18: 64,571,653 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bpifa5 A G 2: 154,164,255 N121S possibly damaging Het
Bpifb4 G A 2: 153,947,283 probably benign Het
Bptf T A 11: 107,061,692 T2112S probably benign Het
Btnl4 T C 17: 34,469,311 K498E probably benign Het
Calhm2 A G 19: 47,141,030 probably null Het
Caps2 T C 10: 112,195,790 F265L possibly damaging Het
Casp3 G T 8: 46,636,227 C170F probably benign Het
Ccdc39 T C 3: 33,819,839 R615G probably damaging Het
Cd177 A G 7: 24,752,313 I426T probably benign Het
Cfap53 G A 18: 74,300,150 R102H possibly damaging Het
Cfhr3 G A 1: 139,593,885 noncoding transcript Het
Col7a1 T C 9: 108,980,584 probably benign Het
Cplx3 T C 9: 57,606,074 E24G possibly damaging Het
D11Wsu47e T A 11: 113,687,886 S36T probably benign Het
Dhx30 A G 9: 110,086,714 probably null Het
Dnah8 T A 17: 30,708,358 N1329K probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dok3 A T 13: 55,524,263 F201I probably benign Het
Dpf2 A T 19: 5,902,212 H303Q probably damaging Het
Dtnb A G 12: 3,735,039 probably benign Het
Elk3 T C 10: 93,265,481 E136G probably damaging Het
Ephb1 T C 9: 102,195,130 D150G probably damaging Het
Erbb3 A G 10: 128,577,012 S570P probably benign Het
F2 A T 2: 91,633,311 probably null Het
Fanca A T 8: 123,308,513 M231K probably damaging Het
Fbxo34 T C 14: 47,530,257 V358A probably benign Het
Foxp1 C T 6: 98,930,122 E666K probably damaging Het
Fto A G 8: 91,401,802 probably null Het
Gbp2 C T 3: 142,630,758 R290C possibly damaging Het
Grik2 T G 10: 49,422,597 S343R probably damaging Het
Heatr5b A T 17: 78,768,545 M1448K probably benign Het
Hmgn3 A T 9: 83,146,429 probably null Het
Htt T C 5: 34,846,003 V1274A probably benign Het
Kcnh8 A G 17: 52,894,005 D489G probably damaging Het
Kcnip3 A T 2: 127,458,397 probably benign Het
Kdm5a A G 6: 120,402,671 T647A possibly damaging Het
Krt72 T C 15: 101,786,056 R135G probably damaging Het
Larp7 T A 3: 127,544,209 K400N probably damaging Het
Lifr T C 15: 7,169,272 probably null Het
Lima1 G A 15: 99,780,472 P696L probably damaging Het
Lrrc8e T G 8: 4,235,239 probably null Het
Map1a A G 2: 121,298,602 R116G probably damaging Het
Map3k13 A G 16: 21,905,249 E327G possibly damaging Het
Med13 A G 11: 86,345,962 V123A possibly damaging Het
Megf8 A C 7: 25,328,540 H205P probably benign Het
Met G A 6: 17,555,632 probably null Het
Mfsd14b A C 13: 65,087,150 V71G possibly damaging Het
Mpl T A 4: 118,443,536 T599S probably benign Het
Myh15 A T 16: 49,061,581 D62V probably damaging Het
Myo5a A G 9: 75,174,015 T961A probably benign Het
Myrfl A G 10: 116,776,760 Y895H probably damaging Het
Nap1l1 T C 10: 111,490,363 probably benign Het
Ncapd3 T A 9: 27,041,507 Y111N probably benign Het
Nlrc3 A G 16: 3,948,249 probably benign Het
Nsun2 G T 13: 69,633,242 V657L probably benign Het
Olfr1026 A T 2: 85,923,378 I37F probably benign Het
Olfr1247 T A 2: 89,609,220 N294I probably benign Het
Olfr142 T C 2: 90,252,934 D18G probably benign Het
Olfr1511 C A 14: 52,389,826 G316* probably null Het
Olfr195 G A 16: 59,149,754 M301I probably benign Het
Olfr596 T C 7: 103,310,164 S148P probably damaging Het
Olfr646 A T 7: 104,107,142 I288F possibly damaging Het
Olfr780 T A 10: 129,322,016 M131K possibly damaging Het
Osbpl3 A T 6: 50,299,403 V795D probably benign Het
Osbpl5 T C 7: 143,709,549 D155G probably damaging Het
Parm1 G A 5: 91,594,264 V164I probably benign Het
Pgd A T 4: 149,156,810 probably benign Het
Pkp1 G A 1: 135,878,182 R593W probably damaging Het
Polr2l A T 7: 141,473,342 V53E probably damaging Het
Ppp4c G T 7: 126,787,288 T29K probably benign Het
Ppp4r4 T A 12: 103,600,520 probably benign Het
Ptprd A G 4: 76,100,474 S688P probably benign Het
Rab3b A T 4: 108,890,389 I28F probably damaging Het
Rnase4 T C 14: 51,105,095 L92P probably benign Het
Rnpc3 T C 3: 113,620,106 E229G probably benign Het
Rtraf A T 14: 19,816,206 D147E possibly damaging Het
Rttn G A 18: 89,042,966 G1086D probably benign Het
Ryr2 A G 13: 11,705,633 probably null Het
Sft2d2 T C 1: 165,183,861 I126V probably benign Het
Skap1 G T 11: 96,723,410 probably benign Het
Slc14a2 A T 18: 78,157,179 L753* probably null Het
Slc25a5 G A X: 36,795,755 A9T probably benign Het
Slc30a5 T C 13: 100,814,770 probably benign Het
Slc5a4b A C 10: 76,064,036 I456S possibly damaging Het
Slc9a4 A T 1: 40,603,070 S400C probably damaging Het
Slx1b T A 7: 126,692,640 H84L probably damaging Het
Sptbn1 T C 11: 30,150,008 Y190C probably damaging Het
Stk32b T C 5: 37,531,566 Q138R probably damaging Het
Syt6 C A 3: 103,620,890 D308E probably damaging Het
Sytl2 G A 7: 90,395,166 D572N probably damaging Het
Taok2 A T 7: 126,879,433 L109Q probably damaging Het
Tbl1xr1 T C 3: 22,179,319 probably benign Het
Tlk1 A G 2: 70,714,158 I711T probably benign Het
Trf A G 9: 103,222,933 probably null Het
Trpc2 A G 7: 102,084,365 T548A possibly damaging Het
Ttbk2 A T 2: 120,825,296 I29N possibly damaging Het
Tti1 A T 2: 157,993,372 C989S probably damaging Het
Txndc8 A G 4: 58,000,256 Y108H probably benign Het
Ugt2b1 A T 5: 86,917,680 V500D possibly damaging Het
Vmn1r34 A G 6: 66,637,664 I30T possibly damaging Het
Vmn2r115 A G 17: 23,360,100 K849R probably null Het
Vmn2r76 T A 7: 86,226,115 probably null Het
Vps13c T A 9: 67,927,472 S1694R probably benign Het
Wdfy3 G T 5: 101,836,172 P3509T probably benign Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wdr60 T C 12: 116,255,935 D129G possibly damaging Het
Wnt8b T A 19: 44,493,667 W40R probably benign Het
Xrra1 A G 7: 99,910,968 I384V possibly damaging Het
Zfp11 A T 5: 129,657,907 H163Q probably damaging Het
Other mutations in Capn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Capn3 APN 2 120486482 intron probably benign
IGL00976:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL01538:Capn3 APN 2 120502186 splice site probably null
IGL01564:Capn3 APN 2 120480708 missense probably damaging 1.00
IGL02527:Capn3 APN 2 120504485 missense probably damaging 0.99
IGL02605:Capn3 APN 2 120496037 missense probably damaging 0.98
IGL02678:Capn3 APN 2 120502998 missense probably damaging 1.00
IGL02899:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL03255:Capn3 APN 2 120489708 missense probably damaging 1.00
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0276:Capn3 UTSW 2 120488065 splice site probably benign
R0714:Capn3 UTSW 2 120491880 missense probably benign 0.32
R1217:Capn3 UTSW 2 120486421 nonsense probably null
R1530:Capn3 UTSW 2 120482208 missense probably damaging 1.00
R1566:Capn3 UTSW 2 120502993 missense possibly damaging 0.72
R1745:Capn3 UTSW 2 120489689 missense possibly damaging 0.87
R1748:Capn3 UTSW 2 120497013 missense probably benign 0.10
R1861:Capn3 UTSW 2 120486482 intron probably benign
R1960:Capn3 UTSW 2 120463940 missense probably benign 0.00
R1971:Capn3 UTSW 2 120480747 missense possibly damaging 0.95
R1994:Capn3 UTSW 2 120495937 missense probably damaging 1.00
R2043:Capn3 UTSW 2 120491901 missense possibly damaging 0.81
R2254:Capn3 UTSW 2 120501251 missense probably benign 0.01
R2255:Capn3 UTSW 2 120501251 missense probably benign 0.01
R3738:Capn3 UTSW 2 120485287 missense possibly damaging 0.85
R3824:Capn3 UTSW 2 120484483 splice site probably benign
R4796:Capn3 UTSW 2 120502998 missense probably damaging 1.00
R5073:Capn3 UTSW 2 120491820 missense probably damaging 1.00
R5116:Capn3 UTSW 2 120485292 missense probably benign 0.00
R5152:Capn3 UTSW 2 120501330 intron probably benign
R5420:Capn3 UTSW 2 120495296 intron probably benign
R5478:Capn3 UTSW 2 120464185 splice site probably null
R5506:Capn3 UTSW 2 120502420 missense probably damaging 0.97
R5664:Capn3 UTSW 2 120477025 missense probably benign 0.04
R5733:Capn3 UTSW 2 120484594 nonsense probably null
R6212:Capn3 UTSW 2 120477186 missense probably benign 0.17
R7176:Capn3 UTSW 2 120504492 missense possibly damaging 0.46
R7219:Capn3 UTSW 2 120503454 missense probably damaging 0.99
R7365:Capn3 UTSW 2 120494814 missense probably damaging 0.98
R7819:Capn3 UTSW 2 120464165 missense probably benign 0.05
R8052:Capn3 UTSW 2 120486386 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTCAACACAGTGGTGAACAAACG -3'
(R):5'- AGCTTTACAGCTCACAGAGCCTGC -3'

Sequencing Primer
(F):5'- TGAACAAACGTGAGCGACC -3'
(R):5'- CTGCCCGCTAGGAAGTTTG -3'
Posted On2013-07-11