Incidental Mutation 'R7144:Grin2b'
ID553630
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7144 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 135733476 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1024 (D1024A)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000053880
AA Change: D1024A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: D1024A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111905
AA Change: D1024A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: D1024A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8746:Grin2b UTSW 6 135922987 missense probably benign 0.02
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8927:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8963:Grin2b UTSW 6 136044009 missense probably damaging 1.00
R9075:Grin2b UTSW 6 135732511 frame shift probably null
R9076:Grin2b UTSW 6 135732511 frame shift probably null
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACTCCCTCCTAGATTTGGC -3'
(R):5'- GAGAACATTTGGCAACCTGC -3'

Sequencing Primer
(F):5'- AGGCTGGCCGCTTCTTTAGAC -3'
(R):5'- ATGGGCTCTATGACTGTG -3'
Posted On2019-05-15