Mutagenetix > Incidental Mutation

Incidental Mutation 'R7144:St8sia1'

553632

Institutional Source

Beutler Lab

Gene Symbol

St8sia1

Ensembl Gene

ENSMUSG00000030283

Gene Name

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1

Synonyms

ST8Sia I, Siat8, Siat8a, GD3S, GD3 synthase, 9330109E03Rik, alpha-2,8-sialyltransferase

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R7144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142821545-142964452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142876669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 156 (D156G)

Ref Sequence

ENSEMBL: ENSMUSP00000032421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032421] [ENSMUST00000205149]

AlphaFold

Q64687

Predicted Effect

probably damaging
Transcript: ENSMUST00000032421
AA Change: D156G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032421
Gene: ENSMUSG00000030283
AA Change: D156G

Domain	Start	End	E-Value	Type
transmembrane domain	27	49	N/A	INTRINSIC
Pfam:Glyco_transf_29	90	344	8.1e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205149

SMART Domains

Protein: ENSMUSP00000145148
Gene: ENSMUSG00000030283

Domain	Start	End	E-Value	Type
transmembrane domain	27	49	N/A	INTRINSIC
transmembrane domain	76	95	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted allele are behaviorally normal with no signs of aberrant brain histology or demyelination. Homozygotes for a knock-out allele are behaviorally intact with normal nervous tissue morphology and sensitivity to Fas-mediated apoptosis but show impaired repair of damaged nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,433,573	I272F	possibly damaging	Het
Adcy10	G	T	1: 165,510,370	M184I	probably benign	Het
Aldoa	G	T	7: 126,796,862	T124N	possibly damaging	Het
Ap4e1	T	A	2: 127,011,807	I55N	probably damaging	Het
Arhgap21	T	C	2: 20,865,387	T913A	probably benign	Het
Atrnl1	G	A	19: 58,042,352	E1309K	probably damaging	Het
BC034090	A	T	1: 155,242,031	C114S	probably damaging	Het
Brinp2	A	G	1: 158,295,424		probably null	Het
Ccna1	G	T	3: 55,045,699	H408Q	probably benign	Het
Cd209g	T	G	8: 4,135,189		probably benign	Het
Cdc20b	A	G	13: 113,083,371	I433V	probably benign	Het
Cdk2ap1	G	A	5: 124,354,358	P5L	probably damaging	Het
Cep128	T	C	12: 91,294,159	E310G	probably damaging	Het
Cflar	G	T	1: 58,753,848	V458F		Het
Clec4b2	A	G	6: 123,181,384	T70A	probably benign	Het
Cntnap5c	A	G	17: 58,286,888	T741A	probably benign	Het
Csf3r	A	T	4: 126,043,722	T800S	probably benign	Het
Csnk1g2	T	C	10: 80,637,899	Y67H	probably damaging	Het
Cyp2c67	A	T	19: 39,615,694	V406E	probably benign	Het
Dnah10	A	G	5: 124,822,942	D3868G	probably damaging	Het
Dnah7a	A	T	1: 53,698,708		probably null	Het
Dst	A	G	1: 34,152,243	N208S	probably damaging	Het
Echdc3	A	G	2: 6,206,413		probably null	Het
Edrf1	T	C	7: 133,637,849	S13P	probably benign	Het
Ephb1	T	C	9: 101,964,077	Y734C	probably damaging	Het
Eps8l1	A	G	7: 4,472,185	Y325C	probably damaging	Het
Evc2	A	G	5: 37,386,839	D644G	probably damaging	Het
Eya4	A	C	10: 23,173,045	D54E	probably benign	Het
Filip1	T	C	9: 79,820,213	S375G	possibly damaging	Het
Fmo9	A	G	1: 166,677,620	M68T	probably benign	Het
Gemin5	G	C	11: 58,141,663	P772A	probably benign	Het
Gle1	T	G	2: 29,943,793	C401G	probably damaging	Het
Gm14548	A	G	7: 3,897,616	V45A	probably damaging	Het
Gm7298	A	T	6: 121,761,587	I376F	probably damaging	Het
Gpr35	A	C	1: 92,982,631	I22L	probably benign	Het
Grin2b	T	G	6: 135,733,476	D1024A	possibly damaging	Het
Hmcn1	T	C	1: 150,663,873	N2956D	probably damaging	Het
Htt	T	C	5: 34,846,006	L1275P	probably damaging	Het
Ibtk	T	C	9: 85,743,691	D2G	probably benign	Het
Il16	T	A	7: 83,646,451	D1170V	probably damaging	Het
Iqgap3	T	A	3: 88,116,910	I1513N	probably damaging	Het
Kiz	T	G	2: 146,950,510		probably null	Het
Krt12	A	T	11: 99,416,013	*488K	probably null	Het
Lap3	A	T	5: 45,496,948	T83S	probably benign	Het
Lars2	T	A	9: 123,431,993	S410T	probably damaging	Het
Limch1	A	G	5: 67,017,658	T518A	probably benign	Het
Lrrc49	A	T	9: 60,615,156	S381T	probably damaging	Het
Lrrk2	A	G	15: 91,734,055	D919G	possibly damaging	Het
Mmp1a	A	T	9: 7,475,318	S363C	probably damaging	Het
Mrps22	A	C	9: 98,601,471		probably null	Het
Mybpc3	T	C	2: 91,134,604	I1066T	probably benign	Het
Myo10	A	T	15: 25,723,925	N215I	probably damaging	Het
Myocd	A	C	11: 65,218,648	L99R	probably damaging	Het
Nadk	T	G	4: 155,589,336	I394S	probably damaging	Het
Nadsyn1	T	C	7: 143,811,215	N251S	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Ncapd2	G	A	6: 125,176,670	P694L	probably benign	Het
Olfr1101	G	T	2: 86,988,820	R119S	probably damaging	Het
Olfr1243	T	C	2: 89,527,557	I284M	probably damaging	Het
Olfr317	A	C	11: 58,732,745	L140R	probably damaging	Het
Olfr705	T	A	7: 106,873,868	I126F	probably damaging	Het
Pcdhb13	T	A	18: 37,443,256	I229K	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Phactr3	A	G	2: 178,302,736	N409S	probably damaging	Het
Pik3c2g	C	A	6: 139,629,870	P305Q	probably damaging	Het
Pik3r4	G	A	9: 105,650,584	V379M	probably damaging	Het
Pkd1l2	A	T	8: 117,076,131	C250*	probably null	Het
Pramef17	A	C	4: 143,991,533	S447A	probably benign	Het
Rapgef6	A	C	11: 54,657,365	T792P	possibly damaging	Het
Rexo5	A	G	7: 119,805,191	D170G	probably damaging	Het
Rnf17	G	A	14: 56,512,332		probably null	Het
Sept11	A	G	5: 93,156,866	I181V	probably benign	Het
Serpina1e	T	G	12: 103,947,018	*414C	probably null	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3bp2	A	G	5: 34,561,631	N560S	probably benign	Het
Slc25a25	A	G	2: 32,419,166	F221S	probably damaging	Het
Spag17	G	T	3: 100,027,401		probably null	Het
Sspn	T	C	6: 145,961,155	L104P	probably damaging	Het
St18	A	C	1: 6,833,594	E693A	probably damaging	Het
St6galnac3	T	C	3: 153,411,532	I185V	possibly damaging	Het
Syne2	C	A	12: 76,005,378	S4092R	probably benign	Het
Tll1	T	A	8: 64,124,945	D76V	possibly damaging	Het
Tmco1	C	T	1: 167,308,453		probably benign	Het
Tnfaip3	T	A	10: 19,007,281	T179S	probably benign	Het
Trav16	T	C	14: 53,743,639	I95T	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Unc79	A	G	12: 103,142,626	M2166V	probably benign	Het
Vmn2r1	A	G	3: 64,089,941	I339M	probably damaging	Het
Vwa5b1	A	G	4: 138,605,431		probably null	Het
Washc4	A	T	10: 83,573,774		probably null	Het
Wisp1	T	A	15: 66,913,030	V184E	probably damaging	Het
Wiz	A	G	17: 32,357,628	S642P	possibly damaging	Het
Zeb2	T	A	2: 45,110,041	K60N	possibly damaging	Het
Zfat	T	A	15: 68,178,782	T797S	probably benign	Het
Zfp74	T	C	7: 29,935,165	K373E	probably damaging	Het
Zswim5	T	C	4: 116,975,976		probably null	Het

Other mutations in St8sia1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02081:St8sia1	APN	6	142829227	missense	probably benign	0.00
IGL02138:St8sia1	APN	6	142963778	utr 5 prime	probably benign
IGL02419:St8sia1	APN	6	142828935	missense	probably damaging	1.00
IGL03407:St8sia1	APN	6	142914049	missense	possibly damaging	0.80
PIT4453001:St8sia1	UTSW	6	142829252	nonsense	probably null
PIT4498001:St8sia1	UTSW	6	142914122	missense	probably damaging	1.00
R0167:St8sia1	UTSW	6	142914181	splice site	probably benign
R0690:St8sia1	UTSW	6	142829254	missense	probably damaging	1.00
R1727:St8sia1	UTSW	6	142876727	missense	probably damaging	0.99
R1743:St8sia1	UTSW	6	142829016	missense	probably damaging	1.00
R1937:St8sia1	UTSW	6	142963672	missense	probably damaging	1.00
R2923:St8sia1	UTSW	6	142829237	missense	probably damaging	1.00
R2983:St8sia1	UTSW	6	142963629	missense	probably damaging	0.99
R3824:St8sia1	UTSW	6	142829025	missense	probably damaging	1.00
R4803:St8sia1	UTSW	6	142867923	missense	probably benign	0.04
R4844:St8sia1	UTSW	6	142829270	missense	possibly damaging	0.82
R4865:St8sia1	UTSW	6	142829070	missense	probably damaging	1.00
R4886:St8sia1	UTSW	6	142914134	missense	probably damaging	0.99
R5170:St8sia1	UTSW	6	142963708	missense	probably damaging	0.99
R5519:St8sia1	UTSW	6	142963561	missense	probably damaging	0.99
R5783:St8sia1	UTSW	6	142963614	missense	possibly damaging	0.83
R6713:St8sia1	UTSW	6	142829282	splice site	probably null
R7017:St8sia1	UTSW	6	142867906	missense	probably damaging	0.98
R7997:St8sia1	UTSW	6	142963650	missense	probably damaging	1.00
Z1176:St8sia1	UTSW	6	142829099	missense	probably damaging	1.00
Z1177:St8sia1	UTSW	6	142828810	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCCTGCTGAGCTTTGAAC -3'
(R):5'- AAATTCCTTGGGGTCTGCTG -3'

Sequencing Primer
(F):5'- CCTGCTGAGCTTTGAACTTTCTTGG -3'
(R):5'- GGTCTGCTGTCAATAATGATTTCAG -3'

Posted On

2019-05-15