Mutagenetix > Incidental Mutation

Incidental Mutation 'R7144:Il16'

553637

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.327) question?

Stock #

R7144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83646451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1170 (D1170V)

Ref Sequence

ENSEMBL: ENSMUSP00000001792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000075418] [ENSMUST00000117410] [ENSMUST00000145610]

AlphaFold

O54824

Predicted Effect

probably damaging
Transcript: ENSMUST00000001792
AA Change: D1170V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: D1170V

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000075418

SMART Domains

Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
START	7	210	8.57e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117410

SMART Domains

Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
Pfam:START	7	196	5.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000145610
AA Change: D472V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,433,573	I272F	possibly damaging	Het
Adcy10	G	T	1: 165,510,370	M184I	probably benign	Het
Aldoa	G	T	7: 126,796,862	T124N	possibly damaging	Het
Ap4e1	T	A	2: 127,011,807	I55N	probably damaging	Het
Arhgap21	T	C	2: 20,865,387	T913A	probably benign	Het
Atrnl1	G	A	19: 58,042,352	E1309K	probably damaging	Het
BC034090	A	T	1: 155,242,031	C114S	probably damaging	Het
Brinp2	A	G	1: 158,295,424		probably null	Het
Ccna1	G	T	3: 55,045,699	H408Q	probably benign	Het
Cd209g	T	G	8: 4,135,189		probably benign	Het
Cdc20b	A	G	13: 113,083,371	I433V	probably benign	Het
Cdk2ap1	G	A	5: 124,354,358	P5L	probably damaging	Het
Cep128	T	C	12: 91,294,159	E310G	probably damaging	Het
Cflar	G	T	1: 58,753,848	V458F		Het
Clec4b2	A	G	6: 123,181,384	T70A	probably benign	Het
Cntnap5c	A	G	17: 58,286,888	T741A	probably benign	Het
Csf3r	A	T	4: 126,043,722	T800S	probably benign	Het
Csnk1g2	T	C	10: 80,637,899	Y67H	probably damaging	Het
Cyp2c67	A	T	19: 39,615,694	V406E	probably benign	Het
Dnah10	A	G	5: 124,822,942	D3868G	probably damaging	Het
Dnah7a	A	T	1: 53,698,708		probably null	Het
Dst	A	G	1: 34,152,243	N208S	probably damaging	Het
Echdc3	A	G	2: 6,206,413		probably null	Het
Edrf1	T	C	7: 133,637,849	S13P	probably benign	Het
Ephb1	T	C	9: 101,964,077	Y734C	probably damaging	Het
Eps8l1	A	G	7: 4,472,185	Y325C	probably damaging	Het
Evc2	A	G	5: 37,386,839	D644G	probably damaging	Het
Eya4	A	C	10: 23,173,045	D54E	probably benign	Het
Filip1	T	C	9: 79,820,213	S375G	possibly damaging	Het
Fmo9	A	G	1: 166,677,620	M68T	probably benign	Het
Gemin5	G	C	11: 58,141,663	P772A	probably benign	Het
Gle1	T	G	2: 29,943,793	C401G	probably damaging	Het
Gm14548	A	G	7: 3,897,616	V45A	probably damaging	Het
Gm7298	A	T	6: 121,761,587	I376F	probably damaging	Het
Gpr35	A	C	1: 92,982,631	I22L	probably benign	Het
Grin2b	T	G	6: 135,733,476	D1024A	possibly damaging	Het
Hmcn1	T	C	1: 150,663,873	N2956D	probably damaging	Het
Htt	T	C	5: 34,846,006	L1275P	probably damaging	Het
Ibtk	T	C	9: 85,743,691	D2G	probably benign	Het
Iqgap3	T	A	3: 88,116,910	I1513N	probably damaging	Het
Kiz	T	G	2: 146,950,510		probably null	Het
Krt12	A	T	11: 99,416,013	*488K	probably null	Het
Lap3	A	T	5: 45,496,948	T83S	probably benign	Het
Lars2	T	A	9: 123,431,993	S410T	probably damaging	Het
Limch1	A	G	5: 67,017,658	T518A	probably benign	Het
Lrrc49	A	T	9: 60,615,156	S381T	probably damaging	Het
Lrrk2	A	G	15: 91,734,055	D919G	possibly damaging	Het
Mmp1a	A	T	9: 7,475,318	S363C	probably damaging	Het
Mrps22	A	C	9: 98,601,471		probably null	Het
Mybpc3	T	C	2: 91,134,604	I1066T	probably benign	Het
Myo10	A	T	15: 25,723,925	N215I	probably damaging	Het
Myocd	A	C	11: 65,218,648	L99R	probably damaging	Het
Nadk	T	G	4: 155,589,336	I394S	probably damaging	Het
Nadsyn1	T	C	7: 143,811,215	N251S	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Ncapd2	G	A	6: 125,176,670	P694L	probably benign	Het
Olfr1101	G	T	2: 86,988,820	R119S	probably damaging	Het
Olfr1243	T	C	2: 89,527,557	I284M	probably damaging	Het
Olfr317	A	C	11: 58,732,745	L140R	probably damaging	Het
Olfr705	T	A	7: 106,873,868	I126F	probably damaging	Het
Pcdhb13	T	A	18: 37,443,256	I229K	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Phactr3	A	G	2: 178,302,736	N409S	probably damaging	Het
Pik3c2g	C	A	6: 139,629,870	P305Q	probably damaging	Het
Pik3r4	G	A	9: 105,650,584	V379M	probably damaging	Het
Pkd1l2	A	T	8: 117,076,131	C250*	probably null	Het
Pramef17	A	C	4: 143,991,533	S447A	probably benign	Het
Rapgef6	A	C	11: 54,657,365	T792P	possibly damaging	Het
Rexo5	A	G	7: 119,805,191	D170G	probably damaging	Het
Rnf17	G	A	14: 56,512,332		probably null	Het
Sept11	A	G	5: 93,156,866	I181V	probably benign	Het
Serpina1e	T	G	12: 103,947,018	*414C	probably null	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3bp2	A	G	5: 34,561,631	N560S	probably benign	Het
Slc25a25	A	G	2: 32,419,166	F221S	probably damaging	Het
Spag17	G	T	3: 100,027,401		probably null	Het
Sspn	T	C	6: 145,961,155	L104P	probably damaging	Het
St18	A	C	1: 6,833,594	E693A	probably damaging	Het
St6galnac3	T	C	3: 153,411,532	I185V	possibly damaging	Het
St8sia1	T	C	6: 142,876,669	D156G	probably damaging	Het
Syne2	C	A	12: 76,005,378	S4092R	probably benign	Het
Tll1	T	A	8: 64,124,945	D76V	possibly damaging	Het
Tmco1	C	T	1: 167,308,453		probably benign	Het
Tnfaip3	T	A	10: 19,007,281	T179S	probably benign	Het
Trav16	T	C	14: 53,743,639	I95T	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Unc79	A	G	12: 103,142,626	M2166V	probably benign	Het
Vmn2r1	A	G	3: 64,089,941	I339M	probably damaging	Het
Vwa5b1	A	G	4: 138,605,431		probably null	Het
Washc4	A	T	10: 83,573,774		probably null	Het
Wisp1	T	A	15: 66,913,030	V184E	probably damaging	Het
Wiz	A	G	17: 32,357,628	S642P	possibly damaging	Het
Zeb2	T	A	2: 45,110,041	K60N	possibly damaging	Het
Zfat	T	A	15: 68,178,782	T797S	probably benign	Het
Zfp74	T	C	7: 29,935,165	K373E	probably damaging	Het
Zswim5	T	C	4: 116,975,976		probably null	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83652351	missense	probably benign
R9267:Il16	UTSW	7	83722549	missense	probably benign	0.01
R9445:Il16	UTSW	7	83688172	nonsense	probably null
R9595:Il16	UTSW	7	83673065	nonsense	probably null
R9651:Il16	UTSW	7	83682856	missense	probably damaging	0.96
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGCCAAAGACAGAATGTACCTC -3'
(R):5'- ATACCTGTCTCAGAGGCCTC -3'

Sequencing Primer
(F):5'- TCAAAAGGCGCATCTCCC -3'
(R):5'- TCTGCCAGCCCTCCCAG -3'

Posted On

2019-05-15