Mutagenetix > Incidental Mutation

Incidental Mutation 'R7144:Abca16'

553640

Institutional Source

Beutler Lab

Gene Symbol

Abca16

Ensembl Gene

ENSMUSG00000051900

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 16

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120409647-120544813 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120433573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 272 (I272F)

Ref Sequence

ENSEMBL: ENSMUSP00000112736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]

AlphaFold

E9PWJ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000056042
AA Change: I272F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: I272F

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	26	455	2.7e-23	PFAM
AAA	537	720	2.01e-7	SMART
Pfam:ABC2_membrane_3	898	1287	4.6e-25	PFAM
low complexity region	1325	1336	N/A	INTRINSIC
low complexity region	1342	1353	N/A	INTRINSIC
AAA	1378	1563	4.23e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120490
AA Change: I272F

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: I272F

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	25	456	2.4e-22	PFAM
AAA	538	721	2.01e-7	SMART
Pfam:ABC2_membrane_3	899	1288	1.1e-27	PFAM
low complexity region	1326	1337	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC
AAA	1379	1564	4.23e-6	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (95/96)

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	G	T	1: 165,510,370	M184I	probably benign	Het
Aldoa	G	T	7: 126,796,862	T124N	possibly damaging	Het
Ap4e1	T	A	2: 127,011,807	I55N	probably damaging	Het
Arhgap21	T	C	2: 20,865,387	T913A	probably benign	Het
Atrnl1	G	A	19: 58,042,352	E1309K	probably damaging	Het
BC034090	A	T	1: 155,242,031	C114S	probably damaging	Het
Brinp2	A	G	1: 158,295,424		probably null	Het
Ccna1	G	T	3: 55,045,699	H408Q	probably benign	Het
Cd209g	T	G	8: 4,135,189		probably benign	Het
Cdc20b	A	G	13: 113,083,371	I433V	probably benign	Het
Cdk2ap1	G	A	5: 124,354,358	P5L	probably damaging	Het
Cep128	T	C	12: 91,294,159	E310G	probably damaging	Het
Cflar	G	T	1: 58,753,848	V458F		Het
Clec4b2	A	G	6: 123,181,384	T70A	probably benign	Het
Cntnap5c	A	G	17: 58,286,888	T741A	probably benign	Het
Csf3r	A	T	4: 126,043,722	T800S	probably benign	Het
Csnk1g2	T	C	10: 80,637,899	Y67H	probably damaging	Het
Cyp2c67	A	T	19: 39,615,694	V406E	probably benign	Het
Dnah10	A	G	5: 124,822,942	D3868G	probably damaging	Het
Dnah7a	A	T	1: 53,698,708		probably null	Het
Dst	A	G	1: 34,152,243	N208S	probably damaging	Het
Echdc3	A	G	2: 6,206,413		probably null	Het
Edrf1	T	C	7: 133,637,849	S13P	probably benign	Het
Ephb1	T	C	9: 101,964,077	Y734C	probably damaging	Het
Eps8l1	A	G	7: 4,472,185	Y325C	probably damaging	Het
Evc2	A	G	5: 37,386,839	D644G	probably damaging	Het
Eya4	A	C	10: 23,173,045	D54E	probably benign	Het
Filip1	T	C	9: 79,820,213	S375G	possibly damaging	Het
Fmo9	A	G	1: 166,677,620	M68T	probably benign	Het
Gemin5	G	C	11: 58,141,663	P772A	probably benign	Het
Gle1	T	G	2: 29,943,793	C401G	probably damaging	Het
Gm14548	A	G	7: 3,897,616	V45A	probably damaging	Het
Gm7298	A	T	6: 121,761,587	I376F	probably damaging	Het
Gpr35	A	C	1: 92,982,631	I22L	probably benign	Het
Grin2b	T	G	6: 135,733,476	D1024A	possibly damaging	Het
Hmcn1	T	C	1: 150,663,873	N2956D	probably damaging	Het
Htt	T	C	5: 34,846,006	L1275P	probably damaging	Het
Ibtk	T	C	9: 85,743,691	D2G	probably benign	Het
Il16	T	A	7: 83,646,451	D1170V	probably damaging	Het
Iqgap3	T	A	3: 88,116,910	I1513N	probably damaging	Het
Kiz	T	G	2: 146,950,510		probably null	Het
Krt12	A	T	11: 99,416,013	*488K	probably null	Het
Lap3	A	T	5: 45,496,948	T83S	probably benign	Het
Lars2	T	A	9: 123,431,993	S410T	probably damaging	Het
Limch1	A	G	5: 67,017,658	T518A	probably benign	Het
Lrrc49	A	T	9: 60,615,156	S381T	probably damaging	Het
Lrrk2	A	G	15: 91,734,055	D919G	possibly damaging	Het
Mmp1a	A	T	9: 7,475,318	S363C	probably damaging	Het
Mrps22	A	C	9: 98,601,471		probably null	Het
Mybpc3	T	C	2: 91,134,604	I1066T	probably benign	Het
Myo10	A	T	15: 25,723,925	N215I	probably damaging	Het
Myocd	A	C	11: 65,218,648	L99R	probably damaging	Het
Nadk	T	G	4: 155,589,336	I394S	probably damaging	Het
Nadsyn1	T	C	7: 143,811,215	N251S	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Ncapd2	G	A	6: 125,176,670	P694L	probably benign	Het
Olfr1101	G	T	2: 86,988,820	R119S	probably damaging	Het
Olfr1243	T	C	2: 89,527,557	I284M	probably damaging	Het
Olfr317	A	C	11: 58,732,745	L140R	probably damaging	Het
Olfr705	T	A	7: 106,873,868	I126F	probably damaging	Het
Pcdhb13	T	A	18: 37,443,256	I229K	probably damaging	Het
Pgbd5	A	T	8: 124,374,317	M400K	possibly damaging	Het
Phactr3	A	G	2: 178,302,736	N409S	probably damaging	Het
Pik3c2g	C	A	6: 139,629,870	P305Q	probably damaging	Het
Pik3r4	G	A	9: 105,650,584	V379M	probably damaging	Het
Pkd1l2	A	T	8: 117,076,131	C250*	probably null	Het
Pramef17	A	C	4: 143,991,533	S447A	probably benign	Het
Rapgef6	A	C	11: 54,657,365	T792P	possibly damaging	Het
Rexo5	A	G	7: 119,805,191	D170G	probably damaging	Het
Rnf17	G	A	14: 56,512,332		probably null	Het
Sept11	A	G	5: 93,156,866	I181V	probably benign	Het
Serpina1e	T	G	12: 103,947,018	*414C	probably null	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3bp2	A	G	5: 34,561,631	N560S	probably benign	Het
Slc25a25	A	G	2: 32,419,166	F221S	probably damaging	Het
Spag17	G	T	3: 100,027,401		probably null	Het
Sspn	T	C	6: 145,961,155	L104P	probably damaging	Het
St18	A	C	1: 6,833,594	E693A	probably damaging	Het
St6galnac3	T	C	3: 153,411,532	I185V	possibly damaging	Het
St8sia1	T	C	6: 142,876,669	D156G	probably damaging	Het
Syne2	C	A	12: 76,005,378	S4092R	probably benign	Het
Tll1	T	A	8: 64,124,945	D76V	possibly damaging	Het
Tmco1	C	T	1: 167,308,453		probably benign	Het
Tnfaip3	T	A	10: 19,007,281	T179S	probably benign	Het
Trav16	T	C	14: 53,743,639	I95T	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Unc79	A	G	12: 103,142,626	M2166V	probably benign	Het
Vmn2r1	A	G	3: 64,089,941	I339M	probably damaging	Het
Vwa5b1	A	G	4: 138,605,431		probably null	Het
Washc4	A	T	10: 83,573,774		probably null	Het
Wisp1	T	A	15: 66,913,030	V184E	probably damaging	Het
Wiz	A	G	17: 32,357,628	S642P	possibly damaging	Het
Zeb2	T	A	2: 45,110,041	K60N	possibly damaging	Het
Zfat	T	A	15: 68,178,782	T797S	probably benign	Het
Zfp74	T	C	7: 29,935,165	K373E	probably damaging	Het
Zswim5	T	C	4: 116,975,976		probably null	Het

Other mutations in Abca16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Abca16	APN	7	120423759	missense	probably benign	0.08
IGL00590:Abca16	APN	7	120423815	missense	probably damaging	1.00
IGL01320:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01322:Abca16	APN	7	120439199	missense	probably damaging	1.00
IGL01613:Abca16	APN	7	120541277	missense	probably benign	0.03
IGL01774:Abca16	APN	7	120477835	missense	probably damaging	1.00
IGL01774:Abca16	APN	7	120421801	splice site	probably benign
IGL01797:Abca16	APN	7	120514537	missense	probably benign	0.15
IGL02406:Abca16	APN	7	120540602	missense	probably damaging	1.00
IGL02437:Abca16	APN	7	120533729	missense	probably benign	0.00
IGL02541:Abca16	APN	7	120514658	missense	possibly damaging	0.91
IGL02576:Abca16	APN	7	120433455	missense	probably benign	0.05
IGL02578:Abca16	APN	7	120423956	critical splice donor site	probably null
IGL03156:Abca16	APN	7	120423851	missense	possibly damaging	0.69
IGL03381:Abca16	APN	7	120527818	missense	probably benign	0.12
PIT4802001:Abca16	UTSW	7	120540128	missense	probably benign	0.31
R0024:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0026:Abca16	UTSW	7	120477923	splice site	probably benign
R0123:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0134:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0225:Abca16	UTSW	7	120540155	missense	probably damaging	1.00
R0346:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R0355:Abca16	UTSW	7	120423798	missense	possibly damaging	0.68
R0358:Abca16	UTSW	7	120544716	missense	probably benign	0.01
R0525:Abca16	UTSW	7	120465810	nonsense	probably null
R0617:Abca16	UTSW	7	120433611	splice site	probably benign
R0625:Abca16	UTSW	7	120435893	missense	probably damaging	1.00
R0835:Abca16	UTSW	7	120465784	missense	probably benign	0.42
R1445:Abca16	UTSW	7	120520033	missense	probably benign	0.41
R1535:Abca16	UTSW	7	120540705	missense	probably benign	0.30
R1567:Abca16	UTSW	7	120431129	missense	probably benign	0.08
R1694:Abca16	UTSW	7	120520084	missense	probably damaging	1.00
R1860:Abca16	UTSW	7	120534763	missense	probably benign	0.02
R1876:Abca16	UTSW	7	120433385	missense	probably damaging	1.00
R1913:Abca16	UTSW	7	120541240	missense	probably benign	0.04
R1940:Abca16	UTSW	7	120433609	splice site	probably benign
R2042:Abca16	UTSW	7	120544718	missense	probably benign
R2115:Abca16	UTSW	7	120540645	missense	probably damaging	1.00
R2122:Abca16	UTSW	7	120519961	missense	probably damaging	1.00
R2265:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2267:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2269:Abca16	UTSW	7	120431160	missense	probably benign	0.03
R2993:Abca16	UTSW	7	120535161	missense	probably damaging	1.00
R3055:Abca16	UTSW	7	120435851	missense	probably benign	0.05
R3956:Abca16	UTSW	7	120527752	missense	probably damaging	0.96
R4114:Abca16	UTSW	7	120527067	missense	probably benign	0.06
R4441:Abca16	UTSW	7	120527801	missense	probably benign	0.04
R4601:Abca16	UTSW	7	120436697	missense	probably damaging	0.98
R4706:Abca16	UTSW	7	120465765	missense	probably damaging	1.00
R4807:Abca16	UTSW	7	120540609	missense	probably damaging	1.00
R4824:Abca16	UTSW	7	120475479	missense	possibly damaging	0.86
R4937:Abca16	UTSW	7	120527086	missense	probably damaging	0.98
R5152:Abca16	UTSW	7	120540623	missense	probably benign	0.02
R5257:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5258:Abca16	UTSW	7	120436769	critical splice donor site	probably null
R5330:Abca16	UTSW	7	120503377	missense	probably benign	0.15
R5388:Abca16	UTSW	7	120540746	critical splice donor site	probably null
R5590:Abca16	UTSW	7	120544772	missense	probably damaging	0.98
R5810:Abca16	UTSW	7	120435932	missense	probably damaging	1.00
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6030:Abca16	UTSW	7	120533798	missense	probably benign
R6161:Abca16	UTSW	7	120540711	missense	probably damaging	1.00
R6313:Abca16	UTSW	7	120527121	missense	probably damaging	1.00
R6485:Abca16	UTSW	7	120427167	nonsense	probably null
R6527:Abca16	UTSW	7	120477772	missense	possibly damaging	0.95
R6772:Abca16	UTSW	7	120527053	missense	probably damaging	1.00
R6885:Abca16	UTSW	7	120520109	missense	probably benign	0.07
R6899:Abca16	UTSW	7	120527041	missense	probably damaging	1.00
R6941:Abca16	UTSW	7	120541147	missense	probably damaging	1.00
R6990:Abca16	UTSW	7	120527727	missense	probably benign	0.00
R7059:Abca16	UTSW	7	120421748	missense	probably benign	0.00
R7146:Abca16	UTSW	7	120527751	missense	possibly damaging	0.46
R7193:Abca16	UTSW	7	120427186	missense	probably damaging	1.00
R7308:Abca16	UTSW	7	120423770	missense	probably benign	0.01
R7449:Abca16	UTSW	7	120435908	missense	possibly damaging	0.95
R7571:Abca16	UTSW	7	120519988	missense	probably benign	0.11
R7617:Abca16	UTSW	7	120503471	nonsense	probably null
R7646:Abca16	UTSW	7	120514714	missense	probably benign	0.04
R7750:Abca16	UTSW	7	120514705	missense	probably benign	0.09
R7763:Abca16	UTSW	7	120514602	missense	probably damaging	1.00
R7840:Abca16	UTSW	7	120475466	missense	probably benign	0.00
R7946:Abca16	UTSW	7	120527175	missense	probably benign	0.01
R8018:Abca16	UTSW	7	120533643	missense	probably benign	0.04
R8170:Abca16	UTSW	7	120465782	missense	probably damaging	1.00
R8413:Abca16	UTSW	7	120423900	missense	probably benign	0.06
R8461:Abca16	UTSW	7	120436695	missense	possibly damaging	0.95
R8858:Abca16	UTSW	7	120453104	missense	probably benign
R8881:Abca16	UTSW	7	120475571	missense	probably benign	0.18
R9272:Abca16	UTSW	7	120477770	missense	probably benign	0.13
R9303:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9305:Abca16	UTSW	7	120527766	missense	probably benign	0.25
R9320:Abca16	UTSW	7	120540097	missense	probably damaging	0.98
R9413:Abca16	UTSW	7	120527199	missense	probably benign	0.01
R9512:Abca16	UTSW	7	120423740	missense	probably benign	0.01
R9559:Abca16	UTSW	7	120421796	critical splice donor site	probably null
R9615:Abca16	UTSW	7	120527181	missense	probably benign	0.01
R9641:Abca16	UTSW	7	120527085	missense	possibly damaging	0.52
R9643:Abca16	UTSW	7	120465800	missense	possibly damaging	0.96
R9674:Abca16	UTSW	7	120475445	critical splice acceptor site	probably null
R9714:Abca16	UTSW	7	120431160	missense	probably benign	0.01
R9799:Abca16	UTSW	7	120533775	missense	probably benign	0.00
R9800:Abca16	UTSW	7	120520060	missense	possibly damaging	0.68
RF020:Abca16	UTSW	7	120533657	missense	possibly damaging	0.90
X0066:Abca16	UTSW	7	120503386	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTATCATGAAAGCAGTGCTGG -3'
(R):5'- GGTGACCAATATCCAGCAATGC -3'

Sequencing Primer
(F):5'- CAGTGCTGGGAAAAAGCTGTTTG -3'
(R):5'- ACATGGAGGTAACCTACTTTCC -3'

Posted On

2019-05-15