Incidental Mutation 'R7144:Lrrc49'
ID 553649
Institutional Source Beutler Lab
Gene Symbol Lrrc49
Ensembl Gene ENSMUSG00000047766
Gene Name leucine rich repeat containing 49
Synonyms D430025H09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 60568859-60688158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60615156 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 381 (S381T)
Ref Sequence ENSEMBL: ENSMUSP00000070606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053171] [ENSMUST00000065603] [ENSMUST00000114032] [ENSMUST00000114034] [ENSMUST00000150060] [ENSMUST00000166168]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053171
AA Change: S21T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057014
Gene: ENSMUSG00000047766
AA Change: S21T

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065603
AA Change: S381T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070606
Gene: ENSMUSG00000047766
AA Change: S381T

DomainStartEndE-ValueType
LRR 199 221 2.84e1 SMART
LRR 243 264 1.49e1 SMART
LRR 265 286 1.37e2 SMART
LRR 287 308 1.62e1 SMART
LRR 309 332 6.77e0 SMART
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114032
AA Change: S309T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109666
Gene: ENSMUSG00000047766
AA Change: S309T

DomainStartEndE-ValueType
LRR 127 149 2.84e1 SMART
LRR 171 192 1.49e1 SMART
LRR 193 214 1.37e2 SMART
LRR 215 236 1.62e1 SMART
LRR 237 260 6.77e0 SMART
low complexity region 306 322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114034
AA Change: S315T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109668
Gene: ENSMUSG00000047766
AA Change: S315T

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150060
AA Change: S315T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118205
Gene: ENSMUSG00000047766
AA Change: S315T

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166168
AA Change: S375T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128842
Gene: ENSMUSG00000047766
AA Change: S375T

DomainStartEndE-ValueType
LRR 193 215 2.84e1 SMART
LRR 237 258 1.49e1 SMART
LRR 259 280 1.37e2 SMART
LRR 281 302 1.62e1 SMART
LRR 303 326 6.77e0 SMART
low complexity region 372 388 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Lrrc49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lrrc49 APN 9 60601320 missense probably damaging 1.00
IGL00468:Lrrc49 APN 9 60687868 unclassified probably benign
IGL00792:Lrrc49 APN 9 60687838 missense probably damaging 0.97
IGL02252:Lrrc49 APN 9 60687859 start codon destroyed probably benign 0.04
IGL02830:Lrrc49 APN 9 60685110 missense probably damaging 1.00
IGL03103:Lrrc49 APN 9 60685033 critical splice donor site probably null
IGL03223:Lrrc49 APN 9 60687845 missense possibly damaging 0.72
IGL03244:Lrrc49 APN 9 60587857 missense probably damaging 1.00
IGL03392:Lrrc49 APN 9 60666280 splice site probably benign
IGL02837:Lrrc49 UTSW 9 60610322 missense probably benign 0.00
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0335:Lrrc49 UTSW 9 60677095 missense probably damaging 0.99
R0399:Lrrc49 UTSW 9 60610246 splice site probably benign
R0607:Lrrc49 UTSW 9 60666357 missense probably benign 0.35
R1396:Lrrc49 UTSW 9 60680527 missense probably damaging 0.99
R1731:Lrrc49 UTSW 9 60621631 missense probably damaging 1.00
R1800:Lrrc49 UTSW 9 60598191 missense probably damaging 1.00
R1817:Lrrc49 UTSW 9 60602776 missense possibly damaging 0.94
R1876:Lrrc49 UTSW 9 60587777 missense possibly damaging 0.77
R1925:Lrrc49 UTSW 9 60649490 missense probably benign 0.07
R2172:Lrrc49 UTSW 9 60602682 missense probably benign 0.25
R2233:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2235:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2927:Lrrc49 UTSW 9 60593746 nonsense probably null
R3955:Lrrc49 UTSW 9 60671359 missense probably damaging 1.00
R4214:Lrrc49 UTSW 9 60666326 missense probably benign 0.33
R4772:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R5283:Lrrc49 UTSW 9 60687178 missense probably benign 0.06
R5801:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6115:Lrrc49 UTSW 9 60615161 missense possibly damaging 0.61
R6488:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6525:Lrrc49 UTSW 9 60598149 missense probably damaging 1.00
R6540:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R6550:Lrrc49 UTSW 9 60677147 missense probably benign 0.13
R6603:Lrrc49 UTSW 9 60593769 splice site probably null
R6878:Lrrc49 UTSW 9 60680148 missense probably damaging 0.99
R7336:Lrrc49 UTSW 9 60677191 missense possibly damaging 0.92
R7541:Lrrc49 UTSW 9 60610403 missense probably damaging 1.00
R7608:Lrrc49 UTSW 9 60602722 missense probably null 1.00
R7739:Lrrc49 UTSW 9 60593692 missense probably benign
R8097:Lrrc49 UTSW 9 60615048 missense probably benign
R8220:Lrrc49 UTSW 9 60610330 missense probably benign
R8442:Lrrc49 UTSW 9 60593625 missense probably benign 0.01
R8458:Lrrc49 UTSW 9 60598173 missense probably benign 0.00
R8692:Lrrc49 UTSW 9 60687162 missense probably damaging 0.97
R9036:Lrrc49 UTSW 9 60587867 missense probably benign 0.17
R9126:Lrrc49 UTSW 9 60671311 missense probably damaging 1.00
R9339:Lrrc49 UTSW 9 60602748 missense probably benign 0.04
Z1176:Lrrc49 UTSW 9 60677221 missense probably damaging 0.99
Z1177:Lrrc49 UTSW 9 60598093 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGTCTAGTCACCATAGTAACC -3'
(R):5'- AATAGGTGTGGACTTAGAAATACGC -3'

Sequencing Primer
(F):5'- CATAGTAACCCATGAGAGTTTCCAGG -3'
(R):5'- GGTGTGGACTTAGAAATACGCAATTC -3'
Posted On 2019-05-15