Incidental Mutation 'R7144:Gemin5'
ID 553661
Institutional Source Beutler Lab
Gene Symbol Gemin5
Ensembl Gene ENSMUSG00000037275
Gene Name gem nuclear organelle associated protein 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 58120002-58168539 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 58141663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Alanine at position 772 (P772A)
Ref Sequence ENSEMBL: ENSMUSP00000131842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]
AlphaFold Q8BX17
Predicted Effect possibly damaging
Transcript: ENSMUST00000035604
AA Change: P772A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: P772A

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102711
AA Change: P772A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: P772A

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172035
AA Change: P772A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: P772A

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Gemin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Gemin5 APN 11 58163817 missense probably damaging 1.00
IGL00540:Gemin5 APN 11 58160818 missense probably damaging 1.00
IGL01521:Gemin5 APN 11 58134918 splice site probably benign
IGL02190:Gemin5 APN 11 58134842 missense probably damaging 1.00
IGL02274:Gemin5 APN 11 58156795 missense possibly damaging 0.80
IGL02494:Gemin5 APN 11 58121757 missense probably benign 0.12
IGL02549:Gemin5 APN 11 58134803 missense probably damaging 1.00
IGL02740:Gemin5 APN 11 58151564 missense probably damaging 1.00
IGL02815:Gemin5 APN 11 58146409 missense probably damaging 1.00
IGL02823:Gemin5 APN 11 58167705 splice site probably benign
IGL02939:Gemin5 APN 11 58156730 missense probably damaging 1.00
Landscape UTSW 11 58163904 missense probably benign 0.16
R0101:Gemin5 UTSW 11 58145496 missense probably damaging 1.00
R0479:Gemin5 UTSW 11 58139551 missense probably benign 0.00
R1481:Gemin5 UTSW 11 58141654 missense probably damaging 1.00
R1642:Gemin5 UTSW 11 58139080 missense probably damaging 1.00
R1648:Gemin5 UTSW 11 58147979 nonsense probably null
R1980:Gemin5 UTSW 11 58136917 missense probably damaging 1.00
R3079:Gemin5 UTSW 11 58145519 missense probably damaging 1.00
R3418:Gemin5 UTSW 11 58156628 splice site probably null
R4260:Gemin5 UTSW 11 58168359 missense probably damaging 0.99
R4396:Gemin5 UTSW 11 58139549 missense probably benign 0.05
R4902:Gemin5 UTSW 11 58164277 missense probably benign 0.18
R5178:Gemin5 UTSW 11 58146518 missense probably benign 0.01
R5296:Gemin5 UTSW 11 58130061 missense probably damaging 1.00
R5350:Gemin5 UTSW 11 58141586 critical splice donor site probably null
R5426:Gemin5 UTSW 11 58125287 missense probably benign 0.00
R5494:Gemin5 UTSW 11 58130700 missense probably damaging 1.00
R5744:Gemin5 UTSW 11 58155183 missense possibly damaging 0.88
R5889:Gemin5 UTSW 11 58122355 missense possibly damaging 0.76
R5984:Gemin5 UTSW 11 58156761 missense probably damaging 1.00
R6844:Gemin5 UTSW 11 58163904 missense probably benign 0.16
R6934:Gemin5 UTSW 11 58147912 missense probably damaging 1.00
R6999:Gemin5 UTSW 11 58125121 missense probably benign 0.00
R7015:Gemin5 UTSW 11 58156740 missense probably damaging 1.00
R7176:Gemin5 UTSW 11 58166002 missense probably benign 0.05
R7540:Gemin5 UTSW 11 58130402 splice site probably null
R7670:Gemin5 UTSW 11 58147928 missense probably benign 0.01
R7717:Gemin5 UTSW 11 58151530 critical splice donor site probably null
R7791:Gemin5 UTSW 11 58124993 missense probably benign 0.04
R7981:Gemin5 UTSW 11 58145405 missense probably damaging 1.00
R8050:Gemin5 UTSW 11 58128860 missense probably benign 0.00
R8307:Gemin5 UTSW 11 58151594 missense probably damaging 1.00
R8353:Gemin5 UTSW 11 58125239 missense probably benign 0.00
R8371:Gemin5 UTSW 11 58126558 missense probably benign
R8453:Gemin5 UTSW 11 58125239 missense probably benign 0.00
R9181:Gemin5 UTSW 11 58130209 missense probably benign 0.00
R9294:Gemin5 UTSW 11 58137748 missense probably benign 0.08
R9400:Gemin5 UTSW 11 58137715 missense probably damaging 1.00
X0066:Gemin5 UTSW 11 58151535 missense probably benign 0.02
Z1186:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1186:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1186:Gemin5 UTSW 11 58130071 missense probably benign
Z1186:Gemin5 UTSW 11 58139510 missense probably benign
Z1186:Gemin5 UTSW 11 58139575 missense probably benign
Z1186:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Z1187:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1187:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1187:Gemin5 UTSW 11 58130071 missense probably benign
Z1187:Gemin5 UTSW 11 58139510 missense probably benign
Z1187:Gemin5 UTSW 11 58139575 missense probably benign
Z1187:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Z1188:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1188:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1188:Gemin5 UTSW 11 58130071 missense probably benign
Z1188:Gemin5 UTSW 11 58139510 missense probably benign
Z1188:Gemin5 UTSW 11 58139575 missense probably benign
Z1188:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Z1189:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1189:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1189:Gemin5 UTSW 11 58130071 missense probably benign
Z1189:Gemin5 UTSW 11 58139510 missense probably benign
Z1189:Gemin5 UTSW 11 58139575 missense probably benign
Z1189:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Z1190:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1190:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1190:Gemin5 UTSW 11 58130071 missense probably benign
Z1190:Gemin5 UTSW 11 58139510 missense probably benign
Z1190:Gemin5 UTSW 11 58139575 missense probably benign
Z1190:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Z1191:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1191:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1191:Gemin5 UTSW 11 58130071 missense probably benign
Z1191:Gemin5 UTSW 11 58139510 missense probably benign
Z1191:Gemin5 UTSW 11 58139575 missense probably benign
Z1191:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Z1192:Gemin5 UTSW 11 58122289 missense probably benign 0.03
Z1192:Gemin5 UTSW 11 58125218 missense probably benign 0.00
Z1192:Gemin5 UTSW 11 58130071 missense probably benign
Z1192:Gemin5 UTSW 11 58139510 missense probably benign
Z1192:Gemin5 UTSW 11 58139575 missense probably benign
Z1192:Gemin5 UTSW 11 58146519 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTAACACAGTTTGCAAAGGTTC -3'
(R):5'- CTGTCAGAAGAGTGCTGTGG -3'

Sequencing Primer
(F):5'- GGTTCATTTGACACAGAGGCTACAC -3'
(R):5'- ACCAGGATGCTTCTGATTCACAG -3'
Posted On 2019-05-15