Incidental Mutation 'R7145:Plxna2'
ID 553686
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms 2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 045223-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194618218-194816869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 194649522 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 419 (V419L)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027952
AA Change: V419L

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: V419L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194790175 missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 splice site probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
R7959:Plxna2 UTSW 1 194793864 frame shift probably null
R7959:Plxna2 UTSW 1 194810962 missense probably damaging 1.00
R7960:Plxna2 UTSW 1 194793864 frame shift probably null
R8261:Plxna2 UTSW 1 194749416 missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194790175 missense probably benign 0.01
R8463:Plxna2 UTSW 1 194644046 missense probably damaging 1.00
R8519:Plxna2 UTSW 1 194793958 missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194796935 missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194788909 missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194793889 missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194788828 missense probably damaging 1.00
R9379:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9385:Plxna2 UTSW 1 194749416 missense possibly damaging 0.95
R9422:Plxna2 UTSW 1 194644422 missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194644384 missense probably benign 0.05
R9484:Plxna2 UTSW 1 194644894 missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTGTCCTCAGGATGACAG -3'
(R):5'- GATCACTACCTCCAAGATGAGTC -3'

Sequencing Primer
(F):5'- GGGAGCCATGTTAGATCCTTCC -3'
(R):5'- TGAGTCCCTTAACTGAAGACG -3'
Posted On 2019-05-15