Incidental Mutation 'R7145:Npnt'
ID 553694
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Name nephronectin
Synonyms POEM, 1110009H02Rik
MMRRC Submission 045223-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R7145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 132587506-132656052 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132615692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 165 (N165S)
Ref Sequence ENSEMBL: ENSMUSP00000091505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
AlphaFold Q91V88
Predicted Effect probably benign
Transcript: ENSMUST00000042729
AA Change: N134S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998
AA Change: N134S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042744
AA Change: N117S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093971
AA Change: N165S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: N165S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117164
AA Change: N148S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: N148S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117456
AA Change: N13S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998
AA Change: N13S

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117811
AA Change: N117S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,775,820 (GRCm39) Y1670H probably damaging Het
Abca12 T C 1: 71,346,212 (GRCm39) K886R possibly damaging Het
Adcy3 G A 12: 4,250,992 (GRCm39) E584K probably benign Het
Ano3 A T 2: 110,693,205 (GRCm39) V131D probably benign Het
Arhgdig C T 17: 26,418,337 (GRCm39) W215* probably null Het
Cad G T 5: 31,224,956 (GRCm39) W953L possibly damaging Het
Calhm2 T C 19: 47,124,080 (GRCm39) Y88C probably benign Het
Cdk5rap2 A T 4: 70,156,468 (GRCm39) D1681E probably benign Het
Cenpl T A 1: 160,910,482 (GRCm39) L143H possibly damaging Het
Cherp T C 8: 73,222,230 (GRCm39) K270E Het
Cmss1 A G 16: 57,131,718 (GRCm39) I136T probably benign Het
Col23a1 T C 11: 51,456,050 (GRCm39) probably null Het
Crnn C A 3: 93,055,689 (GRCm39) D158E probably damaging Het
Dnmt3a A T 12: 3,922,844 (GRCm39) Q149L probably benign Het
Dst T A 1: 34,228,963 (GRCm39) N2185K probably benign Het
Eif1ad18 G T 12: 88,050,597 (GRCm39) C44F probably benign Het
Elp2 T A 18: 24,737,126 (GRCm39) N25K probably benign Het
Ephb4 A T 5: 137,370,308 (GRCm39) D845V probably damaging Het
Esyt3 T C 9: 99,201,627 (GRCm39) T561A probably damaging Het
F3 G T 3: 121,525,235 (GRCm39) V159L probably damaging Het
Fam81a A T 9: 70,017,560 (GRCm39) D128E probably damaging Het
Flot1 T G 17: 36,135,835 (GRCm39) H155Q probably benign Het
Fut9 T A 4: 25,620,507 (GRCm39) K102N probably damaging Het
Gm6309 T C 5: 146,107,100 (GRCm39) Q82R possibly damaging Het
H13 A G 2: 152,522,992 (GRCm39) N102D probably damaging Het
Lamc2 C G 1: 153,006,518 (GRCm39) A878P possibly damaging Het
Lepr C T 4: 101,609,394 (GRCm39) T327I probably benign Het
Lrp2 A G 2: 69,285,152 (GRCm39) probably null Het
Ly86 A G 13: 37,560,986 (GRCm39) K116E probably damaging Het
Mapk8ip2 T A 15: 89,343,201 (GRCm39) F648I possibly damaging Het
Muc16 G A 9: 18,566,876 (GRCm39) T1881I unknown Het
Myh13 T G 11: 67,245,566 (GRCm39) S1069A probably benign Het
Myh4 T A 11: 67,151,054 (GRCm39) I1903N possibly damaging Het
Myo18b A T 5: 112,965,545 (GRCm39) L1341* probably null Het
Naa25 G T 5: 121,555,552 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Ncapg C T 5: 45,827,372 (GRCm39) A3V possibly damaging Het
Ncln T C 10: 81,324,086 (GRCm39) H481R probably benign Het
Nek4 C A 14: 30,704,305 (GRCm39) Q607K probably damaging Het
Neo1 T C 9: 58,796,462 (GRCm39) Y1182C probably damaging Het
Or2l5 C G 16: 19,333,649 (GRCm39) V246L probably damaging Het
Or4p22 C T 2: 88,317,721 (GRCm39) S215L probably damaging Het
Or8b8 A G 9: 37,808,859 (GRCm39) H53R probably benign Het
Or8k30 T C 2: 86,338,872 (GRCm39) L23P probably damaging Het
Otulin T C 15: 27,608,856 (GRCm39) Y229C probably damaging Het
Palld A T 8: 61,985,051 (GRCm39) D1071E unknown Het
Pcdhb20 T C 18: 37,638,142 (GRCm39) S223P probably damaging Het
Pcdhga6 T A 18: 37,840,781 (GRCm39) I167N probably damaging Het
Pcdhgb4 A G 18: 37,854,843 (GRCm39) N413D probably benign Het
Pcdhgb8 T A 18: 37,896,050 (GRCm39) Y373* probably null Het
Plxna2 G T 1: 194,331,830 (GRCm39) V419L probably benign Het
Rpgrip1l A T 8: 91,959,434 (GRCm39) probably null Het
Rsrc2 A G 5: 123,877,630 (GRCm39) probably benign Het
Scaper C T 9: 55,819,395 (GRCm39) D107N unknown Het
Scgb2b3 T A 7: 31,059,573 (GRCm39) Y67F probably benign Het
Scn5a G A 9: 119,315,437 (GRCm39) T1757I probably damaging Het
Sgo2b G A 8: 64,381,218 (GRCm39) P538L probably damaging Het
Slc9a3 A G 13: 74,298,797 (GRCm39) K72R probably damaging Het
Smchd1 T A 17: 71,685,202 (GRCm39) T1409S probably benign Het
Stab1 A T 14: 30,867,030 (GRCm39) probably null Het
Sult2b1 T C 7: 45,383,056 (GRCm39) E242G probably damaging Het
Tcaf1 A T 6: 42,663,687 (GRCm39) H64Q probably damaging Het
Tle6 T C 10: 81,435,910 (GRCm39) T2A possibly damaging Het
Tmem115 T C 9: 107,412,285 (GRCm39) V203A probably benign Het
Tmem45b G A 9: 31,340,337 (GRCm39) T108I probably damaging Het
Tmf1 A T 6: 97,153,079 (GRCm39) D331E probably damaging Het
Txndc9 T C 1: 38,029,377 (GRCm39) Y157C probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r27 C A 6: 124,168,711 (GRCm39) R806S probably benign Het
Vmn2r59 G A 7: 41,695,188 (GRCm39) A408V probably damaging Het
Ythdc1 T C 5: 86,964,467 (GRCm39) V92A probably benign Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132,610,418 (GRCm39) critical splice donor site probably null
IGL01457:Npnt APN 3 132,591,743 (GRCm39) missense probably damaging 1.00
IGL01954:Npnt APN 3 132,615,724 (GRCm39) missense probably damaging 1.00
IGL01999:Npnt APN 3 132,614,160 (GRCm39) missense probably damaging 1.00
IGL02012:Npnt APN 3 132,614,158 (GRCm39) missense probably damaging 1.00
IGL02025:Npnt APN 3 132,596,523 (GRCm39) critical splice donor site probably null
IGL02637:Npnt APN 3 132,590,271 (GRCm39) missense possibly damaging 0.90
R0234:Npnt UTSW 3 132,620,175 (GRCm39) missense possibly damaging 0.82
R0234:Npnt UTSW 3 132,620,175 (GRCm39) missense possibly damaging 0.82
R1680:Npnt UTSW 3 132,612,563 (GRCm39) missense probably benign 0.00
R1729:Npnt UTSW 3 132,620,158 (GRCm39) nonsense probably null
R1773:Npnt UTSW 3 132,610,454 (GRCm39) missense possibly damaging 0.62
R1980:Npnt UTSW 3 132,653,893 (GRCm39) missense probably benign 0.04
R1982:Npnt UTSW 3 132,653,893 (GRCm39) missense probably benign 0.04
R2338:Npnt UTSW 3 132,597,170 (GRCm39) missense probably damaging 1.00
R3800:Npnt UTSW 3 132,612,524 (GRCm39) missense probably damaging 1.00
R4739:Npnt UTSW 3 132,610,452 (GRCm39) missense possibly damaging 0.93
R4790:Npnt UTSW 3 132,596,523 (GRCm39) critical splice donor site probably benign
R5008:Npnt UTSW 3 132,612,218 (GRCm39) missense probably damaging 1.00
R5446:Npnt UTSW 3 132,614,130 (GRCm39) missense probably damaging 1.00
R5471:Npnt UTSW 3 132,620,148 (GRCm39) missense probably benign 0.05
R5538:Npnt UTSW 3 132,610,724 (GRCm39) missense probably damaging 1.00
R5673:Npnt UTSW 3 132,623,258 (GRCm39) missense probably damaging 0.97
R5683:Npnt UTSW 3 132,612,601 (GRCm39) splice site probably null
R5827:Npnt UTSW 3 132,612,536 (GRCm39) missense possibly damaging 0.89
R5857:Npnt UTSW 3 132,614,110 (GRCm39) missense probably damaging 1.00
R5910:Npnt UTSW 3 132,612,179 (GRCm39) missense probably damaging 1.00
R6208:Npnt UTSW 3 132,655,774 (GRCm39) unclassified probably benign
R6358:Npnt UTSW 3 132,610,479 (GRCm39) missense probably benign 0.18
R6875:Npnt UTSW 3 132,615,671 (GRCm39) missense probably damaging 1.00
R7025:Npnt UTSW 3 132,614,157 (GRCm39) missense probably damaging 1.00
R7166:Npnt UTSW 3 132,653,889 (GRCm39) missense probably damaging 1.00
R7287:Npnt UTSW 3 132,612,563 (GRCm39) missense probably benign 0.00
R7344:Npnt UTSW 3 132,614,100 (GRCm39) splice site probably null
R8344:Npnt UTSW 3 132,614,217 (GRCm39) missense probably damaging 1.00
R8717:Npnt UTSW 3 132,614,136 (GRCm39) missense probably damaging 1.00
R8873:Npnt UTSW 3 132,655,816 (GRCm39) start gained probably benign
R8903:Npnt UTSW 3 132,591,764 (GRCm39) missense probably damaging 1.00
R9414:Npnt UTSW 3 132,612,116 (GRCm39) missense probably benign 0.00
R9420:Npnt UTSW 3 132,653,866 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCTTTCATTCCTCGGGCG -3'
(R):5'- CGGACTTTTATCTGTCACCGAAG -3'

Sequencing Primer
(F):5'- GGCGCGCACACAAACAC -3'
(R):5'- ACCGAAGTGATGCTTTCGC -3'
Posted On 2019-05-15