Incidental Mutation 'R7145:Npnt'
ID553694
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Namenephronectin
Synonyms1110009H02Rik, POEM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location132881745-132950291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132909931 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 165 (N165S)
Ref Sequence ENSEMBL: ENSMUSP00000091505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
Predicted Effect probably benign
Transcript: ENSMUST00000042729
AA Change: N134S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998
AA Change: N134S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042744
AA Change: N117S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093971
AA Change: N165S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: N165S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117164
AA Change: N148S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: N148S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117456
AA Change: N13S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998
AA Change: N13S

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117811
AA Change: N117S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132904657 critical splice donor site probably null
IGL01457:Npnt APN 3 132885982 missense probably damaging 1.00
IGL01954:Npnt APN 3 132909963 missense probably damaging 1.00
IGL01999:Npnt APN 3 132908399 missense probably damaging 1.00
IGL02012:Npnt APN 3 132908397 missense probably damaging 1.00
IGL02025:Npnt APN 3 132890762 critical splice donor site probably null
IGL02637:Npnt APN 3 132884510 missense possibly damaging 0.90
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R1680:Npnt UTSW 3 132906802 missense probably benign 0.00
R1729:Npnt UTSW 3 132914397 nonsense probably null
R1773:Npnt UTSW 3 132904693 missense possibly damaging 0.62
R1980:Npnt UTSW 3 132948132 missense probably benign 0.04
R1982:Npnt UTSW 3 132948132 missense probably benign 0.04
R2338:Npnt UTSW 3 132891409 missense probably damaging 1.00
R3800:Npnt UTSW 3 132906763 missense probably damaging 1.00
R4739:Npnt UTSW 3 132904691 missense possibly damaging 0.93
R4790:Npnt UTSW 3 132890762 critical splice donor site probably benign
R5008:Npnt UTSW 3 132906457 missense probably damaging 1.00
R5446:Npnt UTSW 3 132908369 missense probably damaging 1.00
R5471:Npnt UTSW 3 132914387 missense probably benign 0.05
R5538:Npnt UTSW 3 132904963 missense probably damaging 1.00
R5673:Npnt UTSW 3 132917497 missense probably damaging 0.97
R5683:Npnt UTSW 3 132906840 splice site probably null
R5827:Npnt UTSW 3 132906775 missense possibly damaging 0.89
R5857:Npnt UTSW 3 132908349 missense probably damaging 1.00
R5910:Npnt UTSW 3 132906418 missense probably damaging 1.00
R6208:Npnt UTSW 3 132950013 unclassified probably benign
R6358:Npnt UTSW 3 132904718 missense probably benign 0.18
R6875:Npnt UTSW 3 132909910 missense probably damaging 1.00
R7025:Npnt UTSW 3 132908396 missense probably damaging 1.00
R7166:Npnt UTSW 3 132948128 missense probably damaging 1.00
R7287:Npnt UTSW 3 132906802 missense probably benign 0.00
R7344:Npnt UTSW 3 132908339 splice site probably null
R8344:Npnt UTSW 3 132908456 missense probably damaging 1.00
R8717:Npnt UTSW 3 132908375 missense probably damaging 1.00
R8873:Npnt UTSW 3 132950055 start gained probably benign
R8903:Npnt UTSW 3 132886003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTTTCATTCCTCGGGCG -3'
(R):5'- CGGACTTTTATCTGTCACCGAAG -3'

Sequencing Primer
(F):5'- GGCGCGCACACAAACAC -3'
(R):5'- ACCGAAGTGATGCTTTCGC -3'
Posted On2019-05-15