Incidental Mutation 'R7145:Cdk5rap2'
ID553697
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70238231 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1681 (D1681E)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: D1681E

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: D1681E

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACCTTCAGGCTTTCCTATG -3'
(R):5'- AGGAACTGATGTTGACTCGC -3'

Sequencing Primer
(F):5'- CAGGCTTTCCTATGCAACAC -3'
(R):5'- GCTCTCCTGTGACAGTACCAG -3'
Posted On2019-05-15