Incidental Mutation 'R7145:Lepr'
ID553698
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101752197 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 327 (T327I)
Ref Sequence ENSEMBL: ENSMUSP00000037385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably benign
Transcript: ENSMUST00000037552
AA Change: T327I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: T327I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102777
AA Change: T327I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: T327I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106921
AA Change: T327I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: T327I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
aufsetzigen UTSW 4 101752175 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
lowleaning UTSW 4 101814391 splice site probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 splice site probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7023:Lepr UTSW 4 101789287 missense probably damaging 1.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
R8022:Lepr UTSW 4 101782557 missense probably benign 0.32
R8142:Lepr UTSW 4 101765419 missense possibly damaging 0.93
R8227:Lepr UTSW 4 101771362 missense probably damaging 0.99
R8426:Lepr UTSW 4 101814644 missense probably benign 0.12
R8447:Lepr UTSW 4 101814491 missense probably benign 0.08
R8531:Lepr UTSW 4 101765415 missense probably damaging 1.00
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101745614 missense probably damaging 0.99
Z1177:Lepr UTSW 4 101735595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGTTTTATGGACAGGTGC -3'
(R):5'- AGGCACTCACCCTGTAACTG -3'

Sequencing Primer
(F):5'- AGCTCTTTGAAATTTGCCTAGGC -3'
(R):5'- AACCCTGTACTCAAGAGACTCAG -3'
Posted On2019-05-15