Mutagenetix > Incidental Mutation

Incidental Mutation 'R7145:Lepr'

553698

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7145 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101752197 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 327 (T327I)

Ref Sequence

ENSEMBL: ENSMUSP00000037385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]

AlphaFold

P48356

Predicted Effect

probably benign
Transcript: ENSMUST00000037552
AA Change: T327I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: T327I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102777
AA Change: T327I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: T327I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106921
AA Change: T327I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: T327I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,070,059	Y1670H	probably damaging	Het
Abca12	T	C	1: 71,307,053	K886R	possibly damaging	Het
Adcy3	G	A	12: 4,200,992	E584K	probably benign	Het
Ano3	A	T	2: 110,862,860	V131D	probably benign	Het
Arhgdig	C	T	17: 26,199,363	W215*	probably null	Het
Cad	G	T	5: 31,067,612	W953L	possibly damaging	Het
Calhm2	T	C	19: 47,135,641	Y88C	probably benign	Het
Cdk5rap2	A	T	4: 70,238,231	D1681E	probably benign	Het
Cenpl	T	A	1: 161,082,912	L143H	possibly damaging	Het
Cherp	T	C	8: 72,468,386	K270E		Het
Cmss1	A	G	16: 57,311,355	I136T	probably benign	Het
Col23a1	T	C	11: 51,565,223		probably null	Het
Crnn	C	A	3: 93,148,382	D158E	probably damaging	Het
Dnmt3a	A	T	12: 3,872,844	Q149L	probably benign	Het
Dst	T	A	1: 34,189,882	N2185K	probably benign	Het
Elp2	T	A	18: 24,604,069	N25K	probably benign	Het
Ephb4	A	T	5: 137,372,046	D845V	probably damaging	Het
Esyt3	T	C	9: 99,319,574	T561A	probably damaging	Het
F3	G	T	3: 121,731,586	V159L	probably damaging	Het
Fam81a	A	T	9: 70,110,278	D128E	probably damaging	Het
Flot1	T	G	17: 35,824,943	H155Q	probably benign	Het
Fut9	T	A	4: 25,620,507	K102N	probably damaging	Het
Gm16368	G	T	12: 88,083,827	C44F	probably benign	Het
Gm6309	T	C	5: 146,170,290	Q82R	possibly damaging	Het
H13	A	G	2: 152,681,072	N102D	probably damaging	Het
Lamc2	C	G	1: 153,130,772	A878P	possibly damaging	Het
Lrp2	A	G	2: 69,454,808		probably null	Het
Ly86	A	G	13: 37,377,010	K116E	probably damaging	Het
Mapk8ip2	T	A	15: 89,458,998	F648I	possibly damaging	Het
Muc16	G	A	9: 18,655,580	T1881I	unknown	Het
Myh13	T	G	11: 67,354,740	S1069A	probably benign	Het
Myh4	T	A	11: 67,260,228	I1903N	possibly damaging	Het
Myo18b	A	T	5: 112,817,679	L1341*	probably null	Het
Naa25	G	T	5: 121,417,489		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Ncapg	C	T	5: 45,670,030	A3V	possibly damaging	Het
Ncln	T	C	10: 81,488,252	H481R	probably benign	Het
Nek4	C	A	14: 30,982,348	Q607K	probably damaging	Het
Neo1	T	C	9: 58,889,179	Y1182C	probably damaging	Het
Npnt	T	C	3: 132,909,931	N165S	probably benign	Het
Olfr1076	T	C	2: 86,508,528	L23P	probably damaging	Het
Olfr1184	C	T	2: 88,487,377	S215L	probably damaging	Het
Olfr145	A	G	9: 37,897,563	H53R	probably benign	Het
Olfr167	C	G	16: 19,514,899	V246L	probably damaging	Het
Otulin	T	C	15: 27,608,770	Y229C	probably damaging	Het
Palld	A	T	8: 61,532,017	D1071E	unknown	Het
Pcdhb20	T	C	18: 37,505,089	S223P	probably damaging	Het
Pcdhga6	T	A	18: 37,707,728	I167N	probably damaging	Het
Pcdhgb4	A	G	18: 37,721,790	N413D	probably benign	Het
Pcdhgb8	T	A	18: 37,762,997	Y373*	probably null	Het
Plxna2	G	T	1: 194,649,522	V419L	probably benign	Het
Rpgrip1l	A	T	8: 91,232,806		probably null	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Scaper	C	T	9: 55,912,111	D107N	unknown	Het
Scgb2b3	T	A	7: 31,360,148	Y67F	probably benign	Het
Scn5a	G	A	9: 119,486,371	T1757I	probably damaging	Het
Sgo2b	G	A	8: 63,928,184	P538L	probably damaging	Het
Slc9a3	A	G	13: 74,150,678	K72R	probably damaging	Het
Smchd1	T	A	17: 71,378,207	T1409S	probably benign	Het
Stab1	A	T	14: 31,145,073		probably null	Het
Sult2b1	T	C	7: 45,733,632	E242G	probably damaging	Het
Tcaf1	A	T	6: 42,686,753	H64Q	probably damaging	Het
Tle6	T	C	10: 81,600,076	T2A	possibly damaging	Het
Tmem115	T	C	9: 107,535,086	V203A	probably benign	Het
Tmem45b	G	A	9: 31,429,041	T108I	probably damaging	Het
Tmf1	A	T	6: 97,176,118	D331E	probably damaging	Het
Txndc9	T	C	1: 37,990,296	Y157C	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r27	C	A	6: 124,191,752	R806S	probably benign	Het
Vmn2r59	G	A	7: 42,045,764	A408V	probably damaging	Het
Ythdc1	T	C	5: 86,816,608	V92A	probably benign	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
R0140_Lepr_245	UTSW	4	101768067	missense	probably damaging	1.00
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
R8682:Lepr	UTSW	4	101792072	missense	probably benign	0.00
R8897:Lepr	UTSW	4	101792036	missense	probably damaging	0.98
R9096:Lepr	UTSW	4	101774221	missense	possibly damaging	0.95
R9177:Lepr	UTSW	4	101745601	nonsense	probably null
R9241:Lepr	UTSW	4	101814591	missense	probably benign
R9604:Lepr	UTSW	4	101733276	missense	probably benign	0.01
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACGTTTTATGGACAGGTGC -3'
(R):5'- AGGCACTCACCCTGTAACTG -3'

Sequencing Primer
(F):5'- AGCTCTTTGAAATTTGCCTAGGC -3'
(R):5'- AACCCTGTACTCAAGAGACTCAG -3'

Posted On

2019-05-15