Incidental Mutation 'R7145:Tmem115'
ID 553724
Institutional Source Beutler Lab
Gene Symbol Tmem115
Ensembl Gene ENSMUSG00000010045
Gene Name transmembrane protein 115
Synonyms Pl6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock # R7145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107533945-107538673 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107535086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000010189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235]
AlphaFold Q9WUH1
Predicted Effect probably benign
Transcript: ENSMUST00000010189
AA Change: V203A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045
AA Change: V203A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041459
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect probably benign
Transcript: ENSMUST00000194967
Predicted Effect probably benign
Transcript: ENSMUST00000195235
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Tmem115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Tmem115 APN 9 107534582 missense probably damaging 1.00
IGL01142:Tmem115 APN 9 107534645 missense possibly damaging 0.94
IGL01386:Tmem115 APN 9 107534660 missense probably damaging 1.00
IGL01705:Tmem115 APN 9 107535204 missense probably benign 0.44
Gooseneck UTSW 9 107534794 unclassified probably benign
R0746:Tmem115 UTSW 9 107537999 missense probably benign 0.11
R1511:Tmem115 UTSW 9 107534975 missense probably benign 0.04
R4182:Tmem115 UTSW 9 107535283 missense probably damaging 1.00
R4770:Tmem115 UTSW 9 107534957 missense probably benign 0.43
R5097:Tmem115 UTSW 9 107534860 missense probably benign 0.03
R5141:Tmem115 UTSW 9 107537942 missense probably benign 0.01
R5687:Tmem115 UTSW 9 107534855 missense probably benign 0.17
R8299:Tmem115 UTSW 9 107534546 missense possibly damaging 0.94
R8353:Tmem115 UTSW 9 107534798 missense probably benign 0.44
R8453:Tmem115 UTSW 9 107534798 missense probably benign 0.44
R8717:Tmem115 UTSW 9 107537933 missense possibly damaging 0.77
R8901:Tmem115 UTSW 9 107534794 unclassified probably benign
R9017:Tmem115 UTSW 9 107534681 missense probably benign 0.28
R9384:Tmem115 UTSW 9 107534543 missense possibly damaging 0.94
X0067:Tmem115 UTSW 9 107534513 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCTCAAGCAAACTATGGG -3'
(R):5'- AAGTTCCCAGTACCTTCTGC -3'

Sequencing Primer
(F):5'- CCTCAAGCAAACTATGGGAGACTG -3'
(R):5'- CTCCGCATCTTGAGGGTCTG -3'
Posted On 2019-05-15