Incidental Mutation 'R7145:Olfr167'
ID 553740
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor 167
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R7145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 19509558-19522266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 19514899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 246 (V246L)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000054606
AA Change: V246L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: V246L

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214315
AA Change: V246L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
R8671:Olfr167 UTSW 16 19515054 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGGATTCACGGAAGCAACTTGTC -3'
(R):5'- CTTGCACAGACACATGGGTC -3'

Sequencing Primer
(F):5'- GCAAAGCAAATTCTGTGAGTCATCC -3'
(R):5'- CACATGGGTCTATGAGTATACAGTG -3'
Posted On 2019-05-15