Incidental Mutation 'R7146:Nbeal1'
ID 553752
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Name neurobeachin like 1
Synonyms A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 045251-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7146 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 60180599-60338328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 60237151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 684 (V684L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]
AlphaFold E9PYP2
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160980
SMART Domains Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 278 297 N/A INTRINSIC
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 (GRCm38) I895F probably benign Het
Abca16 A G 7: 120,527,751 (GRCm38) N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 (GRCm38) Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 (GRCm38) C702W probably damaging Het
Adk C A 14: 21,326,614 (GRCm38) P27H Het
Ankrd13a T C 5: 114,775,232 (GRCm38) S2P probably damaging Het
Ano1 T C 7: 144,655,656 (GRCm38) H269R probably benign Het
Aox3 T A 1: 58,158,529 (GRCm38) probably null Het
Asl G A 5: 130,024,449 (GRCm38) probably benign Het
Asxl2 A T 12: 3,457,066 (GRCm38) D86V probably damaging Het
Ate1 A T 7: 130,481,778 (GRCm38) probably null Het
Bach2 A G 4: 32,562,670 (GRCm38) D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 (GRCm38) L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 (GRCm38) Y24C unknown Het
Cage1 G T 13: 38,023,049 (GRCm38) N273K probably benign Het
Ccdc51 T A 9: 109,091,780 (GRCm38) I245N probably damaging Het
Cep152 T C 2: 125,614,405 (GRCm38) I229V probably benign Het
Chst4 T A 8: 110,030,731 (GRCm38) S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 (GRCm38) Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 (GRCm38) probably null Het
Cog8 G T 8: 107,052,373 (GRCm38) T424K possibly damaging Het
Cop1 T G 1: 159,244,352 (GRCm38) probably null Het
Cyp2j6 A G 4: 96,545,782 (GRCm38) I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 (GRCm38) T131A probably benign Het
Dnah17 T C 11: 118,082,110 (GRCm38) D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 (GRCm38) D250G probably benign Het
Dnah8 T C 17: 30,769,644 (GRCm38) V3196A possibly damaging Het
Dscam A T 16: 96,829,917 (GRCm38) Y299* probably null Het
Ephb1 A G 9: 101,963,958 (GRCm38) S774P probably damaging Het
Fat1 G A 8: 44,950,925 (GRCm38) V238I probably benign Het
Fermt1 C T 2: 132,934,865 (GRCm38) M234I probably benign Het
Fmnl2 C T 2: 53,068,540 (GRCm38) S212L Het
Frem1 T C 4: 82,922,295 (GRCm38) N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 (GRCm38) M449L probably benign Het
Gad1 T C 2: 70,587,362 (GRCm38) F302L probably benign Het
Gm10800 A AC 2: 98,667,033 (GRCm38) probably null Het
Gm11639 A C 11: 105,022,938 (GRCm38) D4594A probably benign Het
Gm11639 A G 11: 104,967,752 (GRCm38) N3879S unknown Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 (GRCm38) probably benign Het
Gnb3 C T 6: 124,836,924 (GRCm38) probably null Het
Gtf3c1 A T 7: 125,672,821 (GRCm38) M642K possibly damaging Het
Hps3 A T 3: 20,008,886 (GRCm38) W838R probably damaging Het
Ide A T 19: 37,295,944 (GRCm38) W527R Het
Ighe A T 12: 113,272,355 (GRCm38) I117N Het
Ighv1-50 T C 12: 115,119,776 (GRCm38) E108G probably benign Het
Ivl G A 3: 92,572,231 (GRCm38) P176S probably damaging Het
Lamb2 T A 9: 108,484,084 (GRCm38) L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 (GRCm38) R157H probably damaging Het
Lrp1b G T 2: 41,375,994 (GRCm38) C1053* probably null Het
Mcpt9 A T 14: 56,026,988 (GRCm38) S217T probably damaging Het
Mgat4c T G 10: 102,388,496 (GRCm38) N190K probably damaging Het
Mknk1 T A 4: 115,864,592 (GRCm38) V111D probably damaging Het
Mmp11 T C 10: 75,928,446 (GRCm38) T62A probably benign Het
Mmp1b C A 9: 7,385,014 (GRCm38) V212F probably damaging Het
Mmp7 A G 9: 7,697,586 (GRCm38) probably null Het
Muc5b C T 7: 141,863,967 (GRCm38) T3550M possibly damaging Het
Nphp3 A T 9: 104,004,837 (GRCm38) K169* probably null Het
Npy6r G T 18: 44,275,721 (GRCm38) V70F probably benign Het
Nsun2 T A 13: 69,626,553 (GRCm38) probably null Het
Oplah T A 15: 76,302,660 (GRCm38) I652F probably benign Het
Pcdh18 T C 3: 49,755,822 (GRCm38) N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 (GRCm38) V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 (GRCm38) T56N probably benign Het
Pdk4 A G 6: 5,491,068 (GRCm38) probably null Het
Pfkp C A 13: 6,602,781 (GRCm38) V434F probably benign Het
Phospho1 G A 11: 95,830,906 (GRCm38) R134H probably damaging Het
Polg2 G T 11: 106,772,746 (GRCm38) Q374K probably benign Het
Ptpra T C 2: 130,537,651 (GRCm38) probably null Het
Rassf3 C T 10: 121,416,147 (GRCm38) E120K probably benign Het
Reln A T 5: 22,106,097 (GRCm38) S273T probably damaging Het
Scarb1 C T 5: 125,284,025 (GRCm38) A133T probably benign Het
Scn3a T A 2: 65,483,142 (GRCm38) K1142N probably damaging Het
Sema3c G A 5: 17,694,703 (GRCm38) V398I probably benign Het
Serpine1 C A 5: 137,071,064 (GRCm38) Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 (GRCm38) T334M probably damaging Het
Smg7 T C 1: 152,861,825 (GRCm38) N122D probably benign Het
Speer4b T C 5: 27,498,710 (GRCm38) I144V probably benign Het
Spire2 T A 8: 123,369,250 (GRCm38) D671E probably benign Het
Sspo A T 6: 48,501,095 (GRCm38) H5144L probably benign Het
Sstr2 A T 11: 113,625,353 (GRCm38) Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 (GRCm38) F98S probably damaging Het
Syde2 C T 3: 146,007,115 (GRCm38) Q1003* probably null Het
Tapbp G A 17: 33,925,487 (GRCm38) A186T possibly damaging Het
Tcf12 T A 9: 71,883,103 (GRCm38) probably null Het
Tnfrsf22 A T 7: 143,640,819 (GRCm38) C124S probably damaging Het
Txlnb A T 10: 17,827,798 (GRCm38) T235S possibly damaging Het
Uaca T C 9: 60,870,413 (GRCm38) L694P probably damaging Het
Unc13a T A 8: 71,630,553 (GRCm38) N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 (GRCm38) C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 (GRCm38) N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 (GRCm38) E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 (GRCm38) H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 (GRCm38) S756P probably benign Het
Washc5 C A 15: 59,352,501 (GRCm38) E470* probably null Het
Xpot A T 10: 121,606,773 (GRCm38) V508D probably damaging Het
Zfp616 A T 11: 74,085,261 (GRCm38) K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 (GRCm38) N119D probably damaging Het
Zfp729b A G 13: 67,593,376 (GRCm38) S257P probably damaging Het
Zfp82 T A 7: 30,056,167 (GRCm38) T497S probably benign Het
Znrf4 T G 17: 56,512,305 (GRCm38) M1L probably benign Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60,235,191 (GRCm38) nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60,281,883 (GRCm38) missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60,328,103 (GRCm38) missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60,217,225 (GRCm38) missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60,181,741 (GRCm38) missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60,195,011 (GRCm38) critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60,195,143 (GRCm38) missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60,235,353 (GRCm38) missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60,281,341 (GRCm38) missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60,242,625 (GRCm38) critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60,230,628 (GRCm38) missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60,242,625 (GRCm38) critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60,217,255 (GRCm38) missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60,242,535 (GRCm38) critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60,272,259 (GRCm38) critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60,253,501 (GRCm38) missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60,329,335 (GRCm38) missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60,235,237 (GRCm38) missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60,283,987 (GRCm38) missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60,287,444 (GRCm38) splice site probably benign
IGL02945:Nbeal1 APN 1 60,206,410 (GRCm38) missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60,253,413 (GRCm38) missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60,278,727 (GRCm38) missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60,236,459 (GRCm38) missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60,234,868 (GRCm38) missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60,234,869 (GRCm38) missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60,261,586 (GRCm38) critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60,242,567 (GRCm38) nonsense probably null
coach UTSW 1 60,253,481 (GRCm38) nonsense probably null
Committee UTSW 1 60,292,903 (GRCm38) missense probably damaging 1.00
Disgrace UTSW 1 60,281,310 (GRCm38) nonsense probably null
Dravrah UTSW 1 60,284,092 (GRCm38) missense probably damaging 1.00
Harvard UTSW 1 60,235,563 (GRCm38) splice site probably null
horrified UTSW 1 60,244,824 (GRCm38) missense probably damaging 1.00
Lampoon UTSW 1 60,261,586 (GRCm38) critical splice donor site probably null
lawyer UTSW 1 60,310,224 (GRCm38) nonsense probably null
magistrate UTSW 1 60,194,597 (GRCm38) critical splice donor site probably null
Maratimus UTSW 1 60,291,888 (GRCm38) missense probably damaging 1.00
National UTSW 1 60,222,263 (GRCm38) missense possibly damaging 0.95
phainopepla UTSW 1 60,319,687 (GRCm38) missense probably damaging 1.00
R3875_Nbeal1_770 UTSW 1 60,194,599 (GRCm38) splice site probably benign
satirical UTSW 1 60,235,562 (GRCm38) critical splice donor site probably null
silky UTSW 1 60,330,878 (GRCm38) splice site probably benign
stiggs UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60,264,272 (GRCm38) splice site probably benign
P0007:Nbeal1 UTSW 1 60,319,688 (GRCm38) missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60,291,937 (GRCm38) missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60,281,871 (GRCm38) missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60,310,263 (GRCm38) missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60,228,612 (GRCm38) splice site probably benign
R0054:Nbeal1 UTSW 1 60,287,401 (GRCm38) utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60,247,717 (GRCm38) missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60,247,717 (GRCm38) missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60,305,309 (GRCm38) missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60,305,370 (GRCm38) splice site probably benign
R0324:Nbeal1 UTSW 1 60,292,873 (GRCm38) missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60,268,063 (GRCm38) missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60,268,063 (GRCm38) missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60,247,734 (GRCm38) missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60,268,439 (GRCm38) missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60,281,832 (GRCm38) nonsense probably null
R1034:Nbeal1 UTSW 1 60,290,006 (GRCm38) nonsense probably null
R1082:Nbeal1 UTSW 1 60,312,226 (GRCm38) missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60,260,269 (GRCm38) missense probably benign
R1187:Nbeal1 UTSW 1 60,194,528 (GRCm38) missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60,200,939 (GRCm38) missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60,305,291 (GRCm38) missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60,200,119 (GRCm38) missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60,260,334 (GRCm38) missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60,284,092 (GRCm38) missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60,267,941 (GRCm38) nonsense probably null
R1952:Nbeal1 UTSW 1 60,234,840 (GRCm38) missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60,234,840 (GRCm38) missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60,206,344 (GRCm38) missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60,319,687 (GRCm38) missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60,292,964 (GRCm38) splice site probably null
R2055:Nbeal1 UTSW 1 60,311,057 (GRCm38) missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60,270,356 (GRCm38) missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60,305,271 (GRCm38) splice site probably null
R2181:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60,281,895 (GRCm38) missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60,284,006 (GRCm38) missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60,330,878 (GRCm38) splice site probably benign
R2268:Nbeal1 UTSW 1 60,330,878 (GRCm38) splice site probably benign
R2351:Nbeal1 UTSW 1 60,237,098 (GRCm38) missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60,251,352 (GRCm38) missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60,251,370 (GRCm38) missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60,251,413 (GRCm38) splice site probably benign
R3747:Nbeal1 UTSW 1 60,195,023 (GRCm38) missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60,194,599 (GRCm38) splice site probably benign
R4119:Nbeal1 UTSW 1 60,291,870 (GRCm38) missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60,330,948 (GRCm38) missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60,289,946 (GRCm38) missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60,267,774 (GRCm38) missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60,281,310 (GRCm38) nonsense probably null
R4618:Nbeal1 UTSW 1 60,228,731 (GRCm38) intron probably benign
R4673:Nbeal1 UTSW 1 60,329,390 (GRCm38) missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60,235,563 (GRCm38) splice site probably null
R4798:Nbeal1 UTSW 1 60,222,193 (GRCm38) splice site probably null
R4826:Nbeal1 UTSW 1 60,251,342 (GRCm38) missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60,253,375 (GRCm38) missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60,253,375 (GRCm38) missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60,292,903 (GRCm38) missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60,238,654 (GRCm38) missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60,237,179 (GRCm38) missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60,270,328 (GRCm38) missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60,235,559 (GRCm38) nonsense probably null
R5345:Nbeal1 UTSW 1 60,328,210 (GRCm38) critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60,310,999 (GRCm38) missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60,277,194 (GRCm38) missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60,237,152 (GRCm38) missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60,242,602 (GRCm38) missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60,291,847 (GRCm38) missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60,272,221 (GRCm38) missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60,228,791 (GRCm38) intron probably benign
R5918:Nbeal1 UTSW 1 60,267,892 (GRCm38) missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60,248,395 (GRCm38) missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60,248,405 (GRCm38) missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60,181,556 (GRCm38) start gained probably benign
R6113:Nbeal1 UTSW 1 60,222,263 (GRCm38) missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60,251,307 (GRCm38) missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60,257,484 (GRCm38) missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60,222,128 (GRCm38) missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60,295,924 (GRCm38) missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60,248,365 (GRCm38) missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60,238,719 (GRCm38) missense probably benign
R6457:Nbeal1 UTSW 1 60,253,474 (GRCm38) missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60,330,942 (GRCm38) missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60,281,310 (GRCm38) nonsense probably null
R7021:Nbeal1 UTSW 1 60,261,586 (GRCm38) critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60,310,947 (GRCm38) missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60,260,634 (GRCm38) nonsense probably null
R7157:Nbeal1 UTSW 1 60,237,158 (GRCm38) missense probably damaging 1.00
R7209:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60,200,951 (GRCm38) missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60,310,224 (GRCm38) nonsense probably null
R7312:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60,217,196 (GRCm38) missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60,244,810 (GRCm38) missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60,194,597 (GRCm38) critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60,261,584 (GRCm38) missense probably benign
R7507:Nbeal1 UTSW 1 60,235,467 (GRCm38) missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60,277,227 (GRCm38) missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60,244,824 (GRCm38) missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60,257,450 (GRCm38) missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60,319,341 (GRCm38) missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60,291,889 (GRCm38) missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60,260,432 (GRCm38) missense probably benign
R7902:Nbeal1 UTSW 1 60,291,870 (GRCm38) missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60,260,272 (GRCm38) nonsense probably null
R8053:Nbeal1 UTSW 1 60,279,795 (GRCm38) missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60,200,133 (GRCm38) missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60,253,481 (GRCm38) nonsense probably null
R8209:Nbeal1 UTSW 1 60,277,177 (GRCm38) missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60,277,177 (GRCm38) missense probably damaging 0.99
R8549:Nbeal1 UTSW 1 60,235,562 (GRCm38) critical splice donor site probably null
R8560:Nbeal1 UTSW 1 60,235,157 (GRCm38) missense probably benign 0.38
R8753:Nbeal1 UTSW 1 60,268,383 (GRCm38) missense probably damaging 1.00
R8769:Nbeal1 UTSW 1 60,235,211 (GRCm38) missense probably damaging 0.99
R8771:Nbeal1 UTSW 1 60,261,584 (GRCm38) missense probably benign
R8952:Nbeal1 UTSW 1 60,260,300 (GRCm38) missense probably benign 0.01
R9014:Nbeal1 UTSW 1 60,289,959 (GRCm38) missense probably damaging 1.00
R9056:Nbeal1 UTSW 1 60,278,726 (GRCm38) missense probably damaging 1.00
R9091:Nbeal1 UTSW 1 60,268,389 (GRCm38) missense possibly damaging 0.50
R9138:Nbeal1 UTSW 1 60,247,745 (GRCm38) nonsense probably null
R9168:Nbeal1 UTSW 1 60,291,888 (GRCm38) missense probably damaging 1.00
R9200:Nbeal1 UTSW 1 60,281,266 (GRCm38) missense probably damaging 1.00
R9205:Nbeal1 UTSW 1 60,278,680 (GRCm38) missense probably damaging 1.00
R9270:Nbeal1 UTSW 1 60,268,389 (GRCm38) missense possibly damaging 0.50
R9322:Nbeal1 UTSW 1 60,258,659 (GRCm38) missense possibly damaging 0.91
R9405:Nbeal1 UTSW 1 60,310,265 (GRCm38) missense probably damaging 1.00
R9554:Nbeal1 UTSW 1 60,251,128 (GRCm38) nonsense probably null
R9557:Nbeal1 UTSW 1 60,235,350 (GRCm38) missense probably benign
R9560:Nbeal1 UTSW 1 60,329,385 (GRCm38) missense probably damaging 1.00
R9641:Nbeal1 UTSW 1 60,311,088 (GRCm38) missense probably damaging 1.00
R9784:Nbeal1 UTSW 1 60,260,582 (GRCm38) nonsense probably null
X0022:Nbeal1 UTSW 1 60,277,232 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- GTCTTTGGCTTTGCTGAACC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'
Posted On 2019-05-15