Incidental Mutation 'R7146:Fermt1'
ID553762
Institutional Source Beutler Lab
Gene Symbol Fermt1
Ensembl Gene ENSMUSG00000027356
Gene Namefermitin family member 1
SynonymsKindlin-1, 5830467P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7146 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location132904389-132945906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132934865 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 234 (M234I)
Ref Sequence ENSEMBL: ENSMUSP00000047616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038280]
PDB Structure
Solution Structure of the N-terminal domain of kindlin-1 [SOLUTION NMR]
Structural and functional characterisation of the kindlin-1 pleckstrin homology domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000038280
AA Change: M234I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356
AA Change: M234I

DomainStartEndE-ValueType
Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality within 5 days of birth, dehydration, detachment of colonic epithelial cells, and colonic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 I895F probably benign Het
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Aox3 T A 1: 58,158,529 probably null Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Ate1 A T 7: 130,481,778 probably null Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 probably null Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cop1 T G 1: 159,244,352 probably null Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Muc5b C T 7: 141,863,967 T3550M possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Reln A T 5: 22,106,097 S273T probably damaging Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Spire2 T A 8: 123,369,250 D671E probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tcf12 T A 9: 71,883,103 probably null Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Fermt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Fermt1 APN 2 132941951 missense probably damaging 1.00
IGL02511:Fermt1 APN 2 132933166 splice site probably benign
IGL02591:Fermt1 APN 2 132934866 missense possibly damaging 0.89
IGL03107:Fermt1 APN 2 132933139 missense probably damaging 1.00
R0691:Fermt1 UTSW 2 132906733 missense probably damaging 0.99
R1386:Fermt1 UTSW 2 132916058 missense probably damaging 0.99
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1474:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1510:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1558:Fermt1 UTSW 2 132934819 critical splice donor site probably null
R1625:Fermt1 UTSW 2 132922831 missense probably damaging 1.00
R1917:Fermt1 UTSW 2 132922842 missense probably damaging 1.00
R2026:Fermt1 UTSW 2 132918525 missense probably benign 0.11
R2264:Fermt1 UTSW 2 132915190 critical splice donor site probably null
R2512:Fermt1 UTSW 2 132939518 splice site probably null
R3765:Fermt1 UTSW 2 132906702 missense possibly damaging 0.55
R4914:Fermt1 UTSW 2 132906840 missense probably damaging 1.00
R5184:Fermt1 UTSW 2 132941963 missense possibly damaging 0.50
R5259:Fermt1 UTSW 2 132906765 missense probably damaging 0.99
R5303:Fermt1 UTSW 2 132911339 intron probably null
R5304:Fermt1 UTSW 2 132942066 missense probably benign 0.00
R5404:Fermt1 UTSW 2 132934869 missense possibly damaging 0.55
R5569:Fermt1 UTSW 2 132915203 missense possibly damaging 0.89
R7401:Fermt1 UTSW 2 132917559 missense probably benign
R7561:Fermt1 UTSW 2 132916088 missense probably benign 0.02
X0013:Fermt1 UTSW 2 132918586 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAACCCCAGTCTAGGTTCATC -3'
(R):5'- CTTGCCTCATAGTAAGCCCC -3'

Sequencing Primer
(F):5'- CCCAAATTAGACAGTCCCTG -3'
(R):5'- CCGGCTTGTACAGTAAGACCATG -3'
Posted On2019-05-15