Incidental Mutation 'R7146:Bach2'
ID 553767
Institutional Source Beutler Lab
Gene Symbol Bach2
Ensembl Gene ENSMUSG00000040270
Gene Name BTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms E030004N02Rik
MMRRC Submission 045251-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7146 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 32238804-32586108 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32562670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 379 (D379G)
Ref Sequence ENSEMBL: ENSMUSP00000131592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037416] [ENSMUST00000108180] [ENSMUST00000171600]
AlphaFold P97303
Predicted Effect probably damaging
Transcript: ENSMUST00000037416
AA Change: D379G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043693
Gene: ENSMUSG00000040270
AA Change: D379G

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
BRLZ 520 584 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108180
AA Change: D379G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103815
Gene: ENSMUSG00000040270
AA Change: D379G

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171600
AA Change: D379G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131592
Gene: ENSMUSG00000040270
AA Change: D379G

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,854,520 (GRCm39) I895F probably benign Het
Abca16 A G 7: 120,126,974 (GRCm39) N1222D possibly damaging Het
Abcc4 A T 14: 118,852,593 (GRCm39) Y499N probably damaging Het
Adgrg7 A C 16: 56,550,605 (GRCm39) C702W probably damaging Het
Adk C A 14: 21,376,682 (GRCm39) P27H Het
Ankrd13a T C 5: 114,913,293 (GRCm39) S2P probably damaging Het
Ano1 T C 7: 144,209,393 (GRCm39) H269R probably benign Het
Aox3 T A 1: 58,197,688 (GRCm39) probably null Het
Asl G A 5: 130,053,290 (GRCm39) probably benign Het
Asxl2 A T 12: 3,507,066 (GRCm39) D86V probably damaging Het
Ate1 A T 7: 130,083,508 (GRCm39) probably null Het
Bdkrb1 T A 12: 105,571,142 (GRCm39) L236Q probably damaging Het
Cacna2d3 T C 14: 29,443,654 (GRCm39) Y24C unknown Het
Cage1 G T 13: 38,207,025 (GRCm39) N273K probably benign Het
Ccdc51 T A 9: 108,920,848 (GRCm39) I245N probably damaging Het
Cep152 T C 2: 125,456,325 (GRCm39) I229V probably benign Het
Chst4 T A 8: 110,757,363 (GRCm39) S167C probably damaging Het
Cntnap4 A T 8: 113,537,268 (GRCm39) Y713F probably damaging Het
Cntnap5b G A 1: 99,978,519 (GRCm39) probably null Het
Cog8 G T 8: 107,779,005 (GRCm39) T424K possibly damaging Het
Cop1 T G 1: 159,071,922 (GRCm39) probably null Het
Cyp2j6 A G 4: 96,434,019 (GRCm39) I97T probably damaging Het
D430041D05Rik T C 2: 104,088,698 (GRCm39) T131A probably benign Het
Dnah17 T C 11: 117,972,936 (GRCm39) D1999G probably damaging Het
Dnah8 A G 17: 30,863,591 (GRCm39) D250G probably benign Het
Dnah8 T C 17: 30,988,618 (GRCm39) V3196A possibly damaging Het
Dscam A T 16: 96,631,117 (GRCm39) Y299* probably null Het
Efcab3 A G 11: 104,858,578 (GRCm39) N3879S unknown Het
Efcab3 A C 11: 104,913,764 (GRCm39) D4594A probably benign Het
Ephb1 A G 9: 101,841,157 (GRCm39) S774P probably damaging Het
Fat1 G A 8: 45,403,962 (GRCm39) V238I probably benign Het
Fermt1 C T 2: 132,776,785 (GRCm39) M234I probably benign Het
Fmnl2 C T 2: 52,958,552 (GRCm39) S212L Het
Frem1 T C 4: 82,840,532 (GRCm39) N1798S possibly damaging Het
Gabrd T A 4: 155,469,863 (GRCm39) M449L probably benign Het
Gad1 T C 2: 70,417,706 (GRCm39) F302L probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,132,697 (GRCm39) probably benign Het
Gnb3 C T 6: 124,813,887 (GRCm39) probably null Het
Gtf3c1 A T 7: 125,271,993 (GRCm39) M642K possibly damaging Het
Hps3 A T 3: 20,063,050 (GRCm39) W838R probably damaging Het
Ide A T 19: 37,273,343 (GRCm39) W527R Het
Ighe A T 12: 113,235,975 (GRCm39) I117N Het
Ighv1-50 T C 12: 115,083,396 (GRCm39) E108G probably benign Het
Ivl G A 3: 92,479,538 (GRCm39) P176S probably damaging Het
Lamb2 T A 9: 108,361,283 (GRCm39) L605Q possibly damaging Het
Lgi3 G A 14: 70,770,832 (GRCm39) R157H probably damaging Het
Lrp1b G T 2: 41,266,006 (GRCm39) C1053* probably null Het
Mcpt9 A T 14: 56,264,445 (GRCm39) S217T probably damaging Het
Mgat4c T G 10: 102,224,357 (GRCm39) N190K probably damaging Het
Mknk1 T A 4: 115,721,789 (GRCm39) V111D probably damaging Het
Mmp11 T C 10: 75,764,280 (GRCm39) T62A probably benign Het
Mmp1b C A 9: 7,385,014 (GRCm39) V212F probably damaging Het
Mmp7 A G 9: 7,697,587 (GRCm39) probably null Het
Muc5b C T 7: 141,417,704 (GRCm39) T3550M possibly damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nphp3 A T 9: 103,882,036 (GRCm39) K169* probably null Het
Npy6r G T 18: 44,408,788 (GRCm39) V70F probably benign Het
Nsun2 T A 13: 69,774,672 (GRCm39) probably null Het
Oplah T A 15: 76,186,860 (GRCm39) I652F probably benign Het
Pcdh18 T C 3: 49,710,271 (GRCm39) N348S probably damaging Het
Pcdhb5 T A 18: 37,454,409 (GRCm39) V263D probably damaging Het
Pcdhga1 C A 18: 37,795,164 (GRCm39) T56N probably benign Het
Pdk4 A G 6: 5,491,068 (GRCm39) probably null Het
Pfkp C A 13: 6,652,817 (GRCm39) V434F probably benign Het
Phospho1 G A 11: 95,721,732 (GRCm39) R134H probably damaging Het
Polg2 G T 11: 106,663,572 (GRCm39) Q374K probably benign Het
Ptpra T C 2: 130,379,571 (GRCm39) probably null Het
Rassf3 C T 10: 121,252,052 (GRCm39) E120K probably benign Het
Reln A T 5: 22,311,095 (GRCm39) S273T probably damaging Het
Scarb1 C T 5: 125,361,089 (GRCm39) A133T probably benign Het
Scn3a T A 2: 65,313,486 (GRCm39) K1142N probably damaging Het
Sema3c G A 5: 17,899,701 (GRCm39) V398I probably benign Het
Serpine1 C A 5: 137,099,918 (GRCm39) Q80H probably damaging Het
Sh3gl1 G A 17: 56,324,646 (GRCm39) T334M probably damaging Het
Smg7 T C 1: 152,737,576 (GRCm39) N122D probably benign Het
Speer4b T C 5: 27,703,708 (GRCm39) I144V probably benign Het
Spire2 T A 8: 124,095,989 (GRCm39) D671E probably benign Het
Sspo A T 6: 48,478,029 (GRCm39) H5144L probably benign Het
Sstr2 A T 11: 113,516,179 (GRCm39) Q366L probably damaging Het
Ssu72 T C 4: 155,815,850 (GRCm39) F98S probably damaging Het
Syde2 C T 3: 145,712,870 (GRCm39) Q1003* probably null Het
Tapbp G A 17: 34,144,461 (GRCm39) A186T possibly damaging Het
Tcf12 T A 9: 71,790,385 (GRCm39) probably null Het
Tnfrsf22 A T 7: 143,194,556 (GRCm39) C124S probably damaging Het
Txlnb A T 10: 17,703,546 (GRCm39) T235S possibly damaging Het
Uaca T C 9: 60,777,695 (GRCm39) L694P probably damaging Het
Unc13a T A 8: 72,083,197 (GRCm39) N1620Y probably damaging Het
Vmn2r10 C T 5: 109,151,200 (GRCm39) C138Y probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r28 T A 7: 5,484,495 (GRCm39) E568D probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Vwa5b1 A G 4: 138,308,923 (GRCm39) S756P probably benign Het
Washc5 C A 15: 59,224,350 (GRCm39) E470* probably null Het
Xpot A T 10: 121,442,678 (GRCm39) V508D probably damaging Het
Zfp616 A T 11: 73,976,087 (GRCm39) K785N possibly damaging Het
Zfp653 T C 9: 21,977,195 (GRCm39) N119D probably damaging Het
Zfp729b A G 13: 67,741,495 (GRCm39) S257P probably damaging Het
Zfp82 T A 7: 29,755,592 (GRCm39) T497S probably benign Het
Znrf4 T G 17: 56,819,305 (GRCm39) M1L probably benign Het
Other mutations in Bach2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Bach2 APN 4 32,580,261 (GRCm39) missense probably damaging 1.00
IGL02137:Bach2 APN 4 32,501,621 (GRCm39) start gained probably benign
IGL02281:Bach2 APN 4 32,562,513 (GRCm39) missense possibly damaging 0.78
IGL02333:Bach2 APN 4 32,575,334 (GRCm39) nonsense probably null
IGL02369:Bach2 APN 4 32,579,975 (GRCm39) missense possibly damaging 0.85
IGL02533:Bach2 APN 4 32,562,451 (GRCm39) missense probably benign 0.00
Magnificat UTSW 4 32,563,324 (GRCm39) missense probably damaging 1.00
R0011:Bach2 UTSW 4 32,244,655 (GRCm39) intron probably benign
R1240:Bach2 UTSW 4 32,563,198 (GRCm39) missense probably damaging 1.00
R1501:Bach2 UTSW 4 32,562,279 (GRCm39) missense possibly damaging 0.86
R2004:Bach2 UTSW 4 32,580,055 (GRCm39) missense probably benign 0.36
R2171:Bach2 UTSW 4 32,501,662 (GRCm39) missense probably damaging 0.97
R3827:Bach2 UTSW 4 32,563,150 (GRCm39) missense probably damaging 1.00
R3829:Bach2 UTSW 4 32,563,150 (GRCm39) missense probably damaging 1.00
R3830:Bach2 UTSW 4 32,563,150 (GRCm39) missense probably damaging 1.00
R4564:Bach2 UTSW 4 32,563,338 (GRCm39) missense probably damaging 1.00
R4660:Bach2 UTSW 4 32,562,777 (GRCm39) missense probably benign
R5132:Bach2 UTSW 4 32,563,396 (GRCm39) intron probably benign
R5307:Bach2 UTSW 4 32,562,683 (GRCm39) missense probably benign 0.11
R5491:Bach2 UTSW 4 32,562,681 (GRCm39) missense probably damaging 1.00
R5860:Bach2 UTSW 4 32,580,268 (GRCm39) missense probably damaging 1.00
R5983:Bach2 UTSW 4 32,563,324 (GRCm39) missense probably damaging 1.00
R6331:Bach2 UTSW 4 32,238,816 (GRCm39) start gained probably benign
R6770:Bach2 UTSW 4 32,575,240 (GRCm39) missense possibly damaging 0.81
R6806:Bach2 UTSW 4 32,575,301 (GRCm39) missense possibly damaging 0.66
R7691:Bach2 UTSW 4 32,580,271 (GRCm39) missense probably damaging 1.00
R8062:Bach2 UTSW 4 32,562,937 (GRCm39) missense probably damaging 1.00
R8192:Bach2 UTSW 4 32,562,294 (GRCm39) missense probably benign 0.04
R8425:Bach2 UTSW 4 32,562,316 (GRCm39) missense probably benign
R8435:Bach2 UTSW 4 32,501,682 (GRCm39) missense possibly damaging 0.82
R8829:Bach2 UTSW 4 32,562,028 (GRCm39) missense probably damaging 0.96
R8854:Bach2 UTSW 4 32,575,263 (GRCm39) missense possibly damaging 0.93
R9329:Bach2 UTSW 4 32,562,175 (GRCm39) missense possibly damaging 0.92
R9739:Bach2 UTSW 4 32,563,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGAGATGGACCGAAAAC -3'
(R):5'- ACCGCAGAGTATGAATGCAC -3'

Sequencing Primer
(F):5'- GAGATGGACCGAAAACAACCCAG -3'
(R):5'- TTGGTCACACGCGCTTG -3'
Posted On 2019-05-15