Incidental Mutation 'R7146:Reln'
ID553775
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7146 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22106097 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 273 (S273T)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: S273T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: S273T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: S273T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: S273T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162876
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 I895F probably benign Het
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Aox3 T A 1: 58,158,529 probably null Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Ate1 A T 7: 130,481,778 probably null Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 probably null Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cop1 T G 1: 159,244,352 probably null Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fermt1 C T 2: 132,934,865 M234I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Muc5b C T 7: 141,863,967 T3550M possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Spire2 T A 8: 123,369,250 D671E probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tcf12 T A 9: 71,883,103 probably null Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
Fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22286896 missense possibly damaging 0.71
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
R7085:Reln UTSW 5 21915087 nonsense probably null
R7091:Reln UTSW 5 21899029 missense probably null 0.08
R7135:Reln UTSW 5 21976596 missense possibly damaging 0.95
R7167:Reln UTSW 5 21942620 missense probably damaging 1.00
R7190:Reln UTSW 5 22047947 missense probably damaging 1.00
R7256:Reln UTSW 5 21978923 missense probably benign 0.03
R7393:Reln UTSW 5 21976351 missense probably damaging 0.99
R7399:Reln UTSW 5 22051367 missense probably damaging 0.99
R7400:Reln UTSW 5 21971934 missense probably damaging 0.99
R7426:Reln UTSW 5 21971953 missense probably damaging 1.00
R7463:Reln UTSW 5 22103435 missense probably damaging 0.98
R7470:Reln UTSW 5 21942741 missense probably damaging 0.99
R7473:Reln UTSW 5 21929127 missense probably benign 0.25
R7501:Reln UTSW 5 22227638 missense possibly damaging 0.91
R7542:Reln UTSW 5 21955181 missense probably damaging 1.00
R7544:Reln UTSW 5 21976278 nonsense probably null
R7588:Reln UTSW 5 21885568 missense probably benign 0.03
R7631:Reln UTSW 5 21971935 missense probably damaging 0.97
R7644:Reln UTSW 5 21978931 missense probably benign 0.39
R7834:Reln UTSW 5 22039635 missense possibly damaging 0.94
R7917:Reln UTSW 5 22039635 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAGCAGCATCCTCCTCAAGC -3'
(R):5'- GTTCATATGTCTCCAAAGAAACCAG -3'

Sequencing Primer
(F):5'- GCATCCTCCTCAAGCAGTAATTATG -3'
(R):5'- TATGTCTCCAAAGAAACCAGAAATG -3'
Posted On2019-05-15