Incidental Mutation 'R7146:Abca14'
ID553789
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene NameATP-binding cassette, sub-family A (ABC1), member 14
Synonyms1700110B15Rik, 4930539G24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026458; MGI: 2388708

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7146 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120203961-120325352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120255297 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 895 (I895F)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: I895F

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: I895F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Aox3 T A 1: 58,158,529 probably null Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Ate1 A T 7: 130,481,778 probably null Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 probably null Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cop1 T G 1: 159,244,352 probably null Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fermt1 C T 2: 132,934,865 M234I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Muc5b C T 7: 141,863,967 T3550M possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Reln A T 5: 22,106,097 S273T probably damaging Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Spire2 T A 8: 123,369,250 D671E probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tcf12 T A 9: 71,883,103 probably null Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 120246853 missense probably damaging 1.00
IGL00800:Abca14 APN 7 120255390 missense probably benign 0.01
IGL00845:Abca14 APN 7 120223951 splice site probably benign
IGL00897:Abca14 APN 7 120216125 splice site probably benign
IGL01524:Abca14 APN 7 120253421 missense possibly damaging 0.57
IGL01747:Abca14 APN 7 120278087 missense probably benign 0.00
IGL02214:Abca14 APN 7 120294175 missense probably benign 0.09
IGL02215:Abca14 APN 7 120253389 missense probably benign 0.00
IGL02253:Abca14 APN 7 120207959 missense probably benign 0.29
IGL02302:Abca14 APN 7 120318745 splice site probably benign
IGL03391:Abca14 APN 7 120246884 missense probably damaging 1.00
F6893:Abca14 UTSW 7 120325038 missense probably damaging 0.98
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0265:Abca14 UTSW 7 120223627 missense probably benign 0.03
R0326:Abca14 UTSW 7 120224419 missense probably damaging 1.00
R0380:Abca14 UTSW 7 120278480 missense probably benign 0.03
R0418:Abca14 UTSW 7 120207434 missense probably damaging 1.00
R0539:Abca14 UTSW 7 120207797 missense probably damaging 1.00
R0574:Abca14 UTSW 7 120224497 missense probably damaging 0.96
R0611:Abca14 UTSW 7 120252256 missense possibly damaging 0.63
R0783:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0785:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0863:Abca14 UTSW 7 120216230 missense probably benign 0.03
R1034:Abca14 UTSW 7 120216147 missense probably damaging 1.00
R1056:Abca14 UTSW 7 120325072 missense probably damaging 1.00
R1072:Abca14 UTSW 7 120212769 missense probably benign
R1244:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1255:Abca14 UTSW 7 120207793 missense probably damaging 0.97
R1271:Abca14 UTSW 7 120325117 missense probably damaging 1.00
R1325:Abca14 UTSW 7 120247322 missense probably benign 0.32
R1457:Abca14 UTSW 7 120289460 missense probably benign 0.00
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1494:Abca14 UTSW 7 120216301 missense probably benign 0.00
R1551:Abca14 UTSW 7 120318878 missense probably benign 0.10
R1607:Abca14 UTSW 7 120251291 missense probably damaging 1.00
R1739:Abca14 UTSW 7 120278306 missense probably benign 0.04
R1856:Abca14 UTSW 7 120278181 missense probably damaging 1.00
R1875:Abca14 UTSW 7 120247967 missense possibly damaging 0.78
R1892:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1898:Abca14 UTSW 7 120251169 missense probably damaging 1.00
R1958:Abca14 UTSW 7 120325159 missense probably damaging 0.98
R2018:Abca14 UTSW 7 120216185 missense probably benign 0.00
R2039:Abca14 UTSW 7 120312264 missense probably damaging 0.98
R2060:Abca14 UTSW 7 120227518 nonsense probably null
R2202:Abca14 UTSW 7 120289541 missense probably benign 0.17
R2205:Abca14 UTSW 7 120247280 missense probably damaging 0.98
R2360:Abca14 UTSW 7 120251208 missense probably benign 0.00
R2401:Abca14 UTSW 7 120283089 missense probably damaging 1.00
R2426:Abca14 UTSW 7 120283223 missense probably benign 0.04
R3433:Abca14 UTSW 7 120294232 missense probably damaging 0.97
R4598:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4599:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4700:Abca14 UTSW 7 120312705 critical splice donor site probably null
R4751:Abca14 UTSW 7 120312177 missense probably benign 0.01
R4826:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4828:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4837:Abca14 UTSW 7 120246980 missense probably benign
R4881:Abca14 UTSW 7 120278249 missense possibly damaging 0.49
R4895:Abca14 UTSW 7 120247349 critical splice donor site probably null
R4928:Abca14 UTSW 7 120324580 missense possibly damaging 0.90
R4990:Abca14 UTSW 7 120312165 missense probably benign 0.00
R5027:Abca14 UTSW 7 120312282 missense probably benign 0.05
R5091:Abca14 UTSW 7 120252274 missense probably damaging 1.00
R5158:Abca14 UTSW 7 120253429 missense probably benign
R5209:Abca14 UTSW 7 120232907 missense probably benign 0.01
R5333:Abca14 UTSW 7 120289546 nonsense probably null
R5424:Abca14 UTSW 7 120211554 missense probably benign 0.01
R5488:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5489:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5716:Abca14 UTSW 7 120246994 critical splice donor site probably null
R6450:Abca14 UTSW 7 120216226 missense probably benign 0.17
R6477:Abca14 UTSW 7 120325102 missense probably benign 0.44
R6652:Abca14 UTSW 7 120246941 missense probably damaging 1.00
R6782:Abca14 UTSW 7 120248085 missense probably damaging 1.00
R6874:Abca14 UTSW 7 120252205 missense possibly damaging 0.71
R6965:Abca14 UTSW 7 120283229 nonsense probably null
R7142:Abca14 UTSW 7 120251183 missense possibly damaging 0.89
R7202:Abca14 UTSW 7 120318013 missense probably damaging 1.00
R7220:Abca14 UTSW 7 120227444 missense possibly damaging 0.45
R7241:Abca14 UTSW 7 120246961 missense probably damaging 1.00
R7291:Abca14 UTSW 7 120289609 nonsense probably null
R7296:Abca14 UTSW 7 120278311 missense probably benign
R7298:Abca14 UTSW 7 120207883 missense probably benign 0.00
R7315:Abca14 UTSW 7 120294118 missense probably benign 0.00
R7776:Abca14 UTSW 7 120232991 critical splice donor site probably null
R7820:Abca14 UTSW 7 120212721 missense probably benign 0.42
R7873:Abca14 UTSW 7 120289569 missense probably benign 0.17
R7956:Abca14 UTSW 7 120289569 missense probably benign 0.17
Z1088:Abca14 UTSW 7 120216135 missense probably benign 0.14
Z1176:Abca14 UTSW 7 120246923 missense not run
Z1177:Abca14 UTSW 7 120317987 missense not run
Predicted Primers PCR Primer
(F):5'- ACACAATGTCGCTGGTCTGC -3'
(R):5'- AGCCTTCAACATGGTCTCAAG -3'

Sequencing Primer
(F):5'- CCAGCTGGGCTCTTCCTTCTG -3'
(R):5'- TGGGTCAAATTGGGGTCCCC -3'
Posted On2019-05-15