Incidental Mutation 'R7146:Muc5b'
ID553792
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Namemucin 5, subtype B, tracheobronchial
SynonymsMUC5, MUC9, 2300002I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7146 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141839070-141873084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141863967 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 3550 (T3550M)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165147
AA Change: T3550M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: T3550M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Meta Mutation Damage Score 0.1502 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 I895F probably benign Het
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Aox3 T A 1: 58,158,529 probably null Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Ate1 A T 7: 130,481,778 probably null Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 probably null Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cop1 T G 1: 159,244,352 probably null Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fermt1 C T 2: 132,934,865 M234I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Reln A T 5: 22,106,097 S273T probably damaging Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Spire2 T A 8: 123,369,250 D671E probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tcf12 T A 9: 71,883,103 probably null Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141841392 missense unknown
IGL00677:Muc5b APN 7 141857894 nonsense probably null
IGL00740:Muc5b APN 7 141855598 missense unknown
IGL01084:Muc5b APN 7 141843449 splice site probably benign
IGL01384:Muc5b APN 7 141846818 missense unknown
IGL01447:Muc5b APN 7 141863094 missense probably benign 0.01
IGL01510:Muc5b APN 7 141859061 missense unknown
IGL01532:Muc5b APN 7 141870006 missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141863240 missense probably benign 0.01
IGL01608:Muc5b APN 7 141846437 missense unknown
IGL01884:Muc5b APN 7 141868083 splice site probably benign
IGL01943:Muc5b APN 7 141861497 missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141871164 missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141863250 missense probably benign 0.04
IGL02110:Muc5b APN 7 141847716 nonsense probably null
IGL02123:Muc5b APN 7 141863757 missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141855632 missense unknown
IGL02141:Muc5b APN 7 141853367 missense unknown
IGL02409:Muc5b APN 7 141861338 missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141868489 missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141867667 missense probably benign 0.33
IGL02504:Muc5b APN 7 141846440 missense unknown
IGL02528:Muc5b APN 7 141864017 missense probably benign 0.01
IGL02534:Muc5b APN 7 141844719 missense unknown
IGL02565:Muc5b APN 7 141857867 missense unknown
IGL02630:Muc5b APN 7 141863231 missense probably benign 0.03
IGL02881:Muc5b APN 7 141857712 missense unknown
IGL02963:Muc5b APN 7 141864264 missense probably damaging 1.00
IGL03003:Muc5b APN 7 141863614 missense probably benign 0.03
IGL03013:Muc5b APN 7 141863928 missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141863069 missense probably benign 0.35
IGL03114:Muc5b APN 7 141858819 nonsense probably null
IGL03150:Muc5b APN 7 141865509 missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141862822 missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141841380 missense unknown
IGL03336:Muc5b APN 7 141864363 missense probably damaging 1.00
IGL03370:Muc5b APN 7 141864777 missense probably benign 0.34
IGL03375:Muc5b APN 7 141861962 missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141864138 missense probably benign 0.21
profligate UTSW 7 141857822 nonsense probably null
wasteful UTSW 7 141858161 missense unknown
R0045:Muc5b UTSW 7 141856818 missense unknown
R0256:Muc5b UTSW 7 141841395 missense unknown
R0256:Muc5b UTSW 7 141843258 missense unknown
R0321:Muc5b UTSW 7 141862235 missense probably benign 0.19
R0391:Muc5b UTSW 7 141865082 missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141864972 missense probably benign 0.20
R0491:Muc5b UTSW 7 141862015 missense probably benign 0.01
R0543:Muc5b UTSW 7 141851785 missense unknown
R0583:Muc5b UTSW 7 141856698 nonsense probably null
R0611:Muc5b UTSW 7 141862436 missense probably benign 0.18
R0625:Muc5b UTSW 7 141846427 missense unknown
R0655:Muc5b UTSW 7 141863942 missense probably benign 0.01
R0845:Muc5b UTSW 7 141850446 splice site probably null
R0863:Muc5b UTSW 7 141867717 missense probably benign 0.18
R0965:Muc5b UTSW 7 141863802 missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141871795 missense probably benign 0.03
R1140:Muc5b UTSW 7 141858996 missense unknown
R1209:Muc5b UTSW 7 141857910 missense unknown
R1333:Muc5b UTSW 7 141868407 missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141858624 missense unknown
R1385:Muc5b UTSW 7 141862137 missense probably benign 0.00
R1463:Muc5b UTSW 7 141859080 missense unknown
R1471:Muc5b UTSW 7 141843234 missense unknown
R1617:Muc5b UTSW 7 141863524 nonsense probably null
R1736:Muc5b UTSW 7 141859107 missense unknown
R1752:Muc5b UTSW 7 141867751 missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141863780 missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141865493 missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141857645 missense unknown
R1902:Muc5b UTSW 7 141864105 missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141846031 missense unknown
R1924:Muc5b UTSW 7 141868223 missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141857684 missense unknown
R1959:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1960:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141863154 missense probably benign 0.01
R2080:Muc5b UTSW 7 141869754 missense probably benign 0.33
R2178:Muc5b UTSW 7 141864116 missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141858864 nonsense probably null
R2229:Muc5b UTSW 7 141861644 missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141862089 missense probably benign 0.00
R2509:Muc5b UTSW 7 141859061 missense unknown
R2510:Muc5b UTSW 7 141859061 missense unknown
R2512:Muc5b UTSW 7 141859076 missense unknown
R2888:Muc5b UTSW 7 141861554 missense probably damaging 0.98
R3054:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3055:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3108:Muc5b UTSW 7 141858759 missense unknown
R3109:Muc5b UTSW 7 141858759 missense unknown
R3113:Muc5b UTSW 7 141846134 missense unknown
R3551:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141867705 missense probably benign 0.18
R3622:Muc5b UTSW 7 141851858 splice site probably benign
R3700:Muc5b UTSW 7 141847249 missense unknown
R3734:Muc5b UTSW 7 141859037 nonsense probably null
R3785:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141863834 missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141864126 missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141859181 missense unknown
R3835:Muc5b UTSW 7 141859181 missense unknown
R3850:Muc5b UTSW 7 141862638 missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141857552 missense unknown
R3909:Muc5b UTSW 7 141849498 missense unknown
R3964:Muc5b UTSW 7 141866968 missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4015:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4017:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4042:Muc5b UTSW 7 141864887 missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141858925 nonsense probably null
R4230:Muc5b UTSW 7 141863522 missense probably benign 0.03
R4400:Muc5b UTSW 7 141861387 missense possibly damaging 0.92
R4455:Muc5b UTSW 7 141858818 missense unknown
R4484:Muc5b UTSW 7 141868450 missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141857984 missense unknown
R4646:Muc5b UTSW 7 141862640 missense probably benign 0.34
R4658:Muc5b UTSW 7 141841398 missense unknown
R4667:Muc5b UTSW 7 141842379 missense unknown
R4690:Muc5b UTSW 7 141842294 missense unknown
R4697:Muc5b UTSW 7 141857361 missense unknown
R4711:Muc5b UTSW 7 141846033 missense unknown
R4713:Muc5b UTSW 7 141849079 nonsense probably null
R4749:Muc5b UTSW 7 141861448 nonsense probably null
R4753:Muc5b UTSW 7 141856853 missense unknown
R4782:Muc5b UTSW 7 141847716 nonsense probably null
R4795:Muc5b UTSW 7 141849567 missense unknown
R4796:Muc5b UTSW 7 141864246 missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141847716 nonsense probably null
R4824:Muc5b UTSW 7 141864185 missense probably damaging 1.00
R4825:Muc5b UTSW 7 141868465 missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141858608 missense unknown
R5073:Muc5b UTSW 7 141859262 missense unknown
R5074:Muc5b UTSW 7 141859262 missense unknown
R5107:Muc5b UTSW 7 141855531 missense unknown
R5152:Muc5b UTSW 7 141865531 missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141850810 missense unknown
R5191:Muc5b UTSW 7 141858539 missense unknown
R5254:Muc5b UTSW 7 141864540 missense probably benign 0.09
R5320:Muc5b UTSW 7 141859001 missense unknown
R5352:Muc5b UTSW 7 141864558 missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141862203 missense unknown
R5417:Muc5b UTSW 7 141858044 missense unknown
R5548:Muc5b UTSW 7 141863942 missense probably benign 0.01
R5551:Muc5b UTSW 7 141868503 missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141847238 missense unknown
R5580:Muc5b UTSW 7 141861347 missense possibly damaging 0.53
R5629:Muc5b UTSW 7 141861299 missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141858983 missense unknown
R5783:Muc5b UTSW 7 141858428 nonsense probably null
R5795:Muc5b UTSW 7 141871741 missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141857396 missense unknown
R5797:Muc5b UTSW 7 141851582 missense unknown
R5806:Muc5b UTSW 7 141862835 missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141858421 missense unknown
R5910:Muc5b UTSW 7 141861311 missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141864173 missense probably damaging 0.99
R5970:Muc5b UTSW 7 141856712 missense unknown
R5990:Muc5b UTSW 7 141858161 missense unknown
R5999:Muc5b UTSW 7 141857379 missense unknown
R6001:Muc5b UTSW 7 141872381 missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141864708 missense probably benign 0.07
R6073:Muc5b UTSW 7 141849060 missense unknown
R6073:Muc5b UTSW 7 141858288 missense unknown
R6112:Muc5b UTSW 7 141863305 missense probably benign 0.01
R6153:Muc5b UTSW 7 141861444 missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141863345 missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141858776 missense unknown
R6178:Muc5b UTSW 7 141856342 missense probably null
R6196:Muc5b UTSW 7 141851596 missense unknown
R6213:Muc5b UTSW 7 141862166 missense probably benign 0.00
R6213:Muc5b UTSW 7 141867619 missense possibly damaging 0.92
R6344:Muc5b UTSW 7 141862971 missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141858665 missense unknown
R6414:Muc5b UTSW 7 141859097 missense unknown
R6521:Muc5b UTSW 7 141859171 nonsense probably null
R6658:Muc5b UTSW 7 141868507 critical splice donor site probably null
R6717:Muc5b UTSW 7 141857822 nonsense probably null
R6737:Muc5b UTSW 7 141857499 missense unknown
R6763:Muc5b UTSW 7 141862284 missense probably benign 0.01
R6817:Muc5b UTSW 7 141862913 missense probably benign 0.06
R6819:Muc5b UTSW 7 141858863 missense unknown
R6916:Muc5b UTSW 7 141864717 missense possibly damaging 0.71
R7030:Muc5b UTSW 7 141842455 missense unknown
R7116:Muc5b UTSW 7 141863750 missense probably benign 0.10
R7134:Muc5b UTSW 7 141857654 missense unknown
R7168:Muc5b UTSW 7 141864017 missense probably benign 0.01
R7182:Muc5b UTSW 7 141842645 missense unknown
R7189:Muc5b UTSW 7 141861061 nonsense probably null
R7207:Muc5b UTSW 7 141862865 missense probably benign 0.01
R7232:Muc5b UTSW 7 141866129 missense possibly damaging 0.53
R7260:Muc5b UTSW 7 141842648 missense unknown
R7269:Muc5b UTSW 7 141857535 missense unknown
R7273:Muc5b UTSW 7 141851570 missense unknown
R7278:Muc5b UTSW 7 141857502 missense unknown
R7307:Muc5b UTSW 7 141842294 missense unknown
R7323:Muc5b UTSW 7 141858707 missense unknown
R7374:Muc5b UTSW 7 141863126 missense probably benign 0.10
R7376:Muc5b UTSW 7 141872550 missense possibly damaging 0.53
R7382:Muc5b UTSW 7 141858948 missense unknown
R7481:Muc5b UTSW 7 141861171 missense unknown
R7497:Muc5b UTSW 7 141861513 missense possibly damaging 0.92
R7554:Muc5b UTSW 7 141858776 missense unknown
R7571:Muc5b UTSW 7 141847249 missense unknown
R7598:Muc5b UTSW 7 141859262 missense unknown
R7609:Muc5b UTSW 7 141861729 missense possibly damaging 0.86
R7615:Muc5b UTSW 7 141864892 nonsense probably null
R7618:Muc5b UTSW 7 141867597 missense probably benign 0.01
R7651:Muc5b UTSW 7 141864023 missense possibly damaging 0.75
R7692:Muc5b UTSW 7 141853229 missense unknown
R7731:Muc5b UTSW 7 141857305 critical splice acceptor site probably null
R7746:Muc5b UTSW 7 141862239 missense probably benign 0.10
R7748:Muc5b UTSW 7 141847805 missense unknown
R7774:Muc5b UTSW 7 141842379 missense unknown
R7783:Muc5b UTSW 7 141857341 missense unknown
Z1088:Muc5b UTSW 7 141862214 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACAGGATCAGCAACTACTG -3'
(R):5'- ACACTTGGGTTGGCAGAGTG -3'

Sequencing Primer
(F):5'- TACTGCCACTCAGACCCTG -3'
(R):5'- AGCATTAGTCACAGTTACTGGTAGG -3'
Posted On2019-05-15