Incidental Mutation 'R7146:Cage1'
ID 553826
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Name cancer antigen 1
Synonyms Ctag3, CAGE1, 4933427I01Rik
MMRRC Submission 045251-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7146 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 38190028-38221045 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 38207025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 273 (N273K)
Ref Sequence ENSEMBL: ENSMUSP00000087278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000089840] [ENSMUST00000110233] [ENSMUST00000131066]
AlphaFold Q5IR70
Predicted Effect possibly damaging
Transcript: ENSMUST00000074969
AA Change: N379K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: N379K

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089840
AA Change: N273K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087278
Gene: ENSMUSG00000044566
AA Change: N273K

DomainStartEndE-ValueType
Pfam:CAGE1 1 420 6.8e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110233
AA Change: N379K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: N379K

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131066
SMART Domains Protein: ENSMUSP00000122393
Gene: ENSMUSG00000044566

DomainStartEndE-ValueType
Pfam:CAGE1 1 318 6.5e-167 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,854,520 (GRCm39) I895F probably benign Het
Abca16 A G 7: 120,126,974 (GRCm39) N1222D possibly damaging Het
Abcc4 A T 14: 118,852,593 (GRCm39) Y499N probably damaging Het
Adgrg7 A C 16: 56,550,605 (GRCm39) C702W probably damaging Het
Adk C A 14: 21,376,682 (GRCm39) P27H Het
Ankrd13a T C 5: 114,913,293 (GRCm39) S2P probably damaging Het
Ano1 T C 7: 144,209,393 (GRCm39) H269R probably benign Het
Aox3 T A 1: 58,197,688 (GRCm39) probably null Het
Asl G A 5: 130,053,290 (GRCm39) probably benign Het
Asxl2 A T 12: 3,507,066 (GRCm39) D86V probably damaging Het
Ate1 A T 7: 130,083,508 (GRCm39) probably null Het
Bach2 A G 4: 32,562,670 (GRCm39) D379G probably damaging Het
Bdkrb1 T A 12: 105,571,142 (GRCm39) L236Q probably damaging Het
Cacna2d3 T C 14: 29,443,654 (GRCm39) Y24C unknown Het
Ccdc51 T A 9: 108,920,848 (GRCm39) I245N probably damaging Het
Cep152 T C 2: 125,456,325 (GRCm39) I229V probably benign Het
Chst4 T A 8: 110,757,363 (GRCm39) S167C probably damaging Het
Cntnap4 A T 8: 113,537,268 (GRCm39) Y713F probably damaging Het
Cntnap5b G A 1: 99,978,519 (GRCm39) probably null Het
Cog8 G T 8: 107,779,005 (GRCm39) T424K possibly damaging Het
Cop1 T G 1: 159,071,922 (GRCm39) probably null Het
Cyp2j6 A G 4: 96,434,019 (GRCm39) I97T probably damaging Het
D430041D05Rik T C 2: 104,088,698 (GRCm39) T131A probably benign Het
Dnah17 T C 11: 117,972,936 (GRCm39) D1999G probably damaging Het
Dnah8 A G 17: 30,863,591 (GRCm39) D250G probably benign Het
Dnah8 T C 17: 30,988,618 (GRCm39) V3196A possibly damaging Het
Dscam A T 16: 96,631,117 (GRCm39) Y299* probably null Het
Efcab3 A G 11: 104,858,578 (GRCm39) N3879S unknown Het
Efcab3 A C 11: 104,913,764 (GRCm39) D4594A probably benign Het
Ephb1 A G 9: 101,841,157 (GRCm39) S774P probably damaging Het
Fat1 G A 8: 45,403,962 (GRCm39) V238I probably benign Het
Fermt1 C T 2: 132,776,785 (GRCm39) M234I probably benign Het
Fmnl2 C T 2: 52,958,552 (GRCm39) S212L Het
Frem1 T C 4: 82,840,532 (GRCm39) N1798S possibly damaging Het
Gabrd T A 4: 155,469,863 (GRCm39) M449L probably benign Het
Gad1 T C 2: 70,417,706 (GRCm39) F302L probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,132,697 (GRCm39) probably benign Het
Gnb3 C T 6: 124,813,887 (GRCm39) probably null Het
Gtf3c1 A T 7: 125,271,993 (GRCm39) M642K possibly damaging Het
Hps3 A T 3: 20,063,050 (GRCm39) W838R probably damaging Het
Ide A T 19: 37,273,343 (GRCm39) W527R Het
Ighe A T 12: 113,235,975 (GRCm39) I117N Het
Ighv1-50 T C 12: 115,083,396 (GRCm39) E108G probably benign Het
Ivl G A 3: 92,479,538 (GRCm39) P176S probably damaging Het
Lamb2 T A 9: 108,361,283 (GRCm39) L605Q possibly damaging Het
Lgi3 G A 14: 70,770,832 (GRCm39) R157H probably damaging Het
Lrp1b G T 2: 41,266,006 (GRCm39) C1053* probably null Het
Mcpt9 A T 14: 56,264,445 (GRCm39) S217T probably damaging Het
Mgat4c T G 10: 102,224,357 (GRCm39) N190K probably damaging Het
Mknk1 T A 4: 115,721,789 (GRCm39) V111D probably damaging Het
Mmp11 T C 10: 75,764,280 (GRCm39) T62A probably benign Het
Mmp1b C A 9: 7,385,014 (GRCm39) V212F probably damaging Het
Mmp7 A G 9: 7,697,587 (GRCm39) probably null Het
Muc5b C T 7: 141,417,704 (GRCm39) T3550M possibly damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nphp3 A T 9: 103,882,036 (GRCm39) K169* probably null Het
Npy6r G T 18: 44,408,788 (GRCm39) V70F probably benign Het
Nsun2 T A 13: 69,774,672 (GRCm39) probably null Het
Oplah T A 15: 76,186,860 (GRCm39) I652F probably benign Het
Pcdh18 T C 3: 49,710,271 (GRCm39) N348S probably damaging Het
Pcdhb5 T A 18: 37,454,409 (GRCm39) V263D probably damaging Het
Pcdhga1 C A 18: 37,795,164 (GRCm39) T56N probably benign Het
Pdk4 A G 6: 5,491,068 (GRCm39) probably null Het
Pfkp C A 13: 6,652,817 (GRCm39) V434F probably benign Het
Phospho1 G A 11: 95,721,732 (GRCm39) R134H probably damaging Het
Polg2 G T 11: 106,663,572 (GRCm39) Q374K probably benign Het
Ptpra T C 2: 130,379,571 (GRCm39) probably null Het
Rassf3 C T 10: 121,252,052 (GRCm39) E120K probably benign Het
Reln A T 5: 22,311,095 (GRCm39) S273T probably damaging Het
Scarb1 C T 5: 125,361,089 (GRCm39) A133T probably benign Het
Scn3a T A 2: 65,313,486 (GRCm39) K1142N probably damaging Het
Sema3c G A 5: 17,899,701 (GRCm39) V398I probably benign Het
Serpine1 C A 5: 137,099,918 (GRCm39) Q80H probably damaging Het
Sh3gl1 G A 17: 56,324,646 (GRCm39) T334M probably damaging Het
Smg7 T C 1: 152,737,576 (GRCm39) N122D probably benign Het
Speer4b T C 5: 27,703,708 (GRCm39) I144V probably benign Het
Spire2 T A 8: 124,095,989 (GRCm39) D671E probably benign Het
Sspo A T 6: 48,478,029 (GRCm39) H5144L probably benign Het
Sstr2 A T 11: 113,516,179 (GRCm39) Q366L probably damaging Het
Ssu72 T C 4: 155,815,850 (GRCm39) F98S probably damaging Het
Syde2 C T 3: 145,712,870 (GRCm39) Q1003* probably null Het
Tapbp G A 17: 34,144,461 (GRCm39) A186T possibly damaging Het
Tcf12 T A 9: 71,790,385 (GRCm39) probably null Het
Tnfrsf22 A T 7: 143,194,556 (GRCm39) C124S probably damaging Het
Txlnb A T 10: 17,703,546 (GRCm39) T235S possibly damaging Het
Uaca T C 9: 60,777,695 (GRCm39) L694P probably damaging Het
Unc13a T A 8: 72,083,197 (GRCm39) N1620Y probably damaging Het
Vmn2r10 C T 5: 109,151,200 (GRCm39) C138Y probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r28 T A 7: 5,484,495 (GRCm39) E568D probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Vwa5b1 A G 4: 138,308,923 (GRCm39) S756P probably benign Het
Washc5 C A 15: 59,224,350 (GRCm39) E470* probably null Het
Xpot A T 10: 121,442,678 (GRCm39) V508D probably damaging Het
Zfp616 A T 11: 73,976,087 (GRCm39) K785N possibly damaging Het
Zfp653 T C 9: 21,977,195 (GRCm39) N119D probably damaging Het
Zfp729b A G 13: 67,741,495 (GRCm39) S257P probably damaging Het
Zfp82 T A 7: 29,755,592 (GRCm39) T497S probably benign Het
Znrf4 T G 17: 56,819,305 (GRCm39) M1L probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38,206,969 (GRCm39) nonsense probably null
IGL01736:Cage1 APN 13 38,206,789 (GRCm39) missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38,206,505 (GRCm39) missense probably damaging 1.00
IGL02267:Cage1 APN 13 38,207,233 (GRCm39) missense probably damaging 1.00
IGL03030:Cage1 APN 13 38,212,123 (GRCm39) missense probably benign
IGL03216:Cage1 APN 13 38,190,153 (GRCm39) splice site probably benign
R0487:Cage1 UTSW 13 38,209,334 (GRCm39) missense probably benign 0.00
R0606:Cage1 UTSW 13 38,200,470 (GRCm39) splice site probably benign
R1015:Cage1 UTSW 13 38,200,451 (GRCm39) missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38,206,856 (GRCm39) missense probably damaging 1.00
R1400:Cage1 UTSW 13 38,216,400 (GRCm39) missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38,207,309 (GRCm39) nonsense probably null
R2057:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2058:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2059:Cage1 UTSW 13 38,207,356 (GRCm39) missense probably benign 0.04
R2197:Cage1 UTSW 13 38,207,029 (GRCm39) missense probably damaging 1.00
R3757:Cage1 UTSW 13 38,209,705 (GRCm39) missense possibly damaging 0.71
R3758:Cage1 UTSW 13 38,209,705 (GRCm39) missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38,203,153 (GRCm39) missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38,209,626 (GRCm39) missense probably damaging 1.00
R4401:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4402:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4403:Cage1 UTSW 13 38,207,078 (GRCm39) missense probably damaging 1.00
R4490:Cage1 UTSW 13 38,207,393 (GRCm39) missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38,209,477 (GRCm39) missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38,203,184 (GRCm39) missense probably benign 0.33
R4950:Cage1 UTSW 13 38,207,302 (GRCm39) missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38,207,406 (GRCm39) missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38,195,387 (GRCm39) nonsense probably null
R5808:Cage1 UTSW 13 38,206,301 (GRCm39) unclassified probably benign
R5845:Cage1 UTSW 13 38,199,682 (GRCm39) missense probably damaging 0.96
R6278:Cage1 UTSW 13 38,200,395 (GRCm39) missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38,209,425 (GRCm39) missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38,206,534 (GRCm39) missense probably damaging 1.00
R7192:Cage1 UTSW 13 38,203,220 (GRCm39) missense probably benign
R7529:Cage1 UTSW 13 38,209,731 (GRCm39) missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38,206,700 (GRCm39) missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38,206,823 (GRCm39) missense probably damaging 1.00
R7837:Cage1 UTSW 13 38,206,381 (GRCm39) missense not run
R8355:Cage1 UTSW 13 38,203,225 (GRCm39) missense probably damaging 0.99
R8435:Cage1 UTSW 13 38,203,161 (GRCm39) missense possibly damaging 0.73
R8466:Cage1 UTSW 13 38,206,987 (GRCm39) missense probably damaging 1.00
R9047:Cage1 UTSW 13 38,201,338 (GRCm39) missense possibly damaging 0.85
R9086:Cage1 UTSW 13 38,206,898 (GRCm39) missense probably damaging 1.00
R9146:Cage1 UTSW 13 38,207,005 (GRCm39) missense probably benign 0.16
R9442:Cage1 UTSW 13 38,196,447 (GRCm39) missense possibly damaging 0.72
R9587:Cage1 UTSW 13 38,207,233 (GRCm39) missense probably damaging 1.00
R9608:Cage1 UTSW 13 38,195,371 (GRCm39) missense possibly damaging 0.73
R9612:Cage1 UTSW 13 38,216,351 (GRCm39) missense probably damaging 0.99
R9630:Cage1 UTSW 13 38,206,855 (GRCm39) missense probably damaging 1.00
R9690:Cage1 UTSW 13 38,203,141 (GRCm39) critical splice donor site probably null
R9736:Cage1 UTSW 13 38,207,393 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGATCTCAGCAATATACCTTTCC -3'
(R):5'- TCAGCTGTGAAGGCTTAGAGC -3'

Sequencing Primer
(F):5'- TCCTGTAAGCGCACGTAATG -3'
(R):5'- GCTTAGAGCCTCTGGAAGAG -3'
Posted On 2019-05-15