Mutagenetix > Incidental Mutations

Incidental Mutation 'R7146:Tapbp'

553842

Institutional Source

Beutler Lab

Gene Symbol

Tapbp

Ensembl Gene

ENSMUSG00000024308

Gene Name

TAP binding protein

Synonyms

TPN, tapasin, D17Wsu91e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7146 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33915899-33929288 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33925487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 186 (A186T)

Ref Sequence

ENSEMBL: ENSMUSP00000025161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

AlphaFold

Q9R233

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025161
AA Change: A186T

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308
AA Change: A186T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047503

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

95% (99/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced and thermolabile MHC class I surface expression due to impaired peptide loading with stabilizing peptides, impaired T cell selection, altered NK repertoire, lower CD8+ T cell numbers, and impaired responses to select class I-restricted antigens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,255,297	I895F	probably benign	Het
Abca16	A	G	7: 120,527,751	N1222D	possibly damaging	Het
Abcc4	A	T	14: 118,615,181	Y499N	probably damaging	Het
Adgrg7	A	C	16: 56,730,242	C702W	probably damaging	Het
Adk	C	A	14: 21,326,614	P27H		Het
Ankrd13a	T	C	5: 114,775,232	S2P	probably damaging	Het
Ano1	T	C	7: 144,655,656	H269R	probably benign	Het
Aox3	T	A	1: 58,158,529		probably null	Het
Asl	G	A	5: 130,024,449		probably benign	Het
Asxl2	A	T	12: 3,457,066	D86V	probably damaging	Het
Ate1	A	T	7: 130,481,778		probably null	Het
Bach2	A	G	4: 32,562,670	D379G	probably damaging	Het
Bdkrb1	T	A	12: 105,604,883	L236Q	probably damaging	Het
Cacna2d3	T	C	14: 29,721,697	Y24C	unknown	Het
Cage1	G	T	13: 38,023,049	N273K	probably benign	Het
Ccdc51	T	A	9: 109,091,780	I245N	probably damaging	Het
Cep152	T	C	2: 125,614,405	I229V	probably benign	Het
Chst4	T	A	8: 110,030,731	S167C	probably damaging	Het
Cntnap4	A	T	8: 112,810,636	Y713F	probably damaging	Het
Cntnap5b	G	A	1: 100,050,794		probably null	Het
Cog8	G	T	8: 107,052,373	T424K	possibly damaging	Het
Cop1	T	G	1: 159,244,352		probably null	Het
Cyp2j6	A	G	4: 96,545,782	I97T	probably damaging	Het
D430041D05Rik	T	C	2: 104,258,353	T131A	probably benign	Het
Dnah17	T	C	11: 118,082,110	D1999G	probably damaging	Het
Dnah8	A	G	17: 30,644,617	D250G	probably benign	Het
Dnah8	T	C	17: 30,769,644	V3196A	possibly damaging	Het
Dscam	A	T	16: 96,829,917	Y299*	probably null	Het
Ephb1	A	G	9: 101,963,958	S774P	probably damaging	Het
Fat1	G	A	8: 44,950,925	V238I	probably benign	Het
Fermt1	C	T	2: 132,934,865	M234I	probably benign	Het
Fmnl2	C	T	2: 53,068,540	S212L		Het
Frem1	T	C	4: 82,922,295	N1798S	possibly damaging	Het
Gabrd	T	A	4: 155,385,406	M449L	probably benign	Het
Gad1	T	C	2: 70,587,362	F302L	probably benign	Het
Gm10800	A	AC	2: 98,667,033		probably null	Het
Gm11639	A	G	11: 104,967,752	N3879S	unknown	Het
Gm11639	A	C	11: 105,022,938	D4594A	probably benign	Het
Gm21886	GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA	GGGCCTGTAGACAGTAGGTGCTCA	18: 80,089,482		probably benign	Het
Gnb3	C	T	6: 124,836,924		probably null	Het
Gtf3c1	A	T	7: 125,672,821	M642K	possibly damaging	Het
Hps3	A	T	3: 20,008,886	W838R	probably damaging	Het
Ide	A	T	19: 37,295,944	W527R		Het
Ighe	A	T	12: 113,272,355	I117N		Het
Ighv1-50	T	C	12: 115,119,776	E108G	probably benign	Het
Ivl	G	A	3: 92,572,231	P176S	probably damaging	Het
Lamb2	T	A	9: 108,484,084	L605Q	possibly damaging	Het
Lgi3	G	A	14: 70,533,392	R157H	probably damaging	Het
Lrp1b	G	T	2: 41,375,994	C1053*	probably null	Het
Mcpt9	A	T	14: 56,026,988	S217T	probably damaging	Het
Mgat4c	T	G	10: 102,388,496	N190K	probably damaging	Het
Mknk1	T	A	4: 115,864,592	V111D	probably damaging	Het
Mmp11	T	C	10: 75,928,446	T62A	probably benign	Het
Mmp1b	C	A	9: 7,385,014	V212F	probably damaging	Het
Mmp7	A	G	9: 7,697,586		probably null	Het
Muc5b	C	T	7: 141,863,967	T3550M	possibly damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nphp3	A	T	9: 104,004,837	K169*	probably null	Het
Npy6r	G	T	18: 44,275,721	V70F	probably benign	Het
Nsun2	T	A	13: 69,626,553		probably null	Het
Oplah	T	A	15: 76,302,660	I652F	probably benign	Het
Pcdh18	T	C	3: 49,755,822	N348S	probably damaging	Het
Pcdhb5	T	A	18: 37,321,356	V263D	probably damaging	Het
Pcdhga1	C	A	18: 37,662,111	T56N	probably benign	Het
Pdk4	A	G	6: 5,491,068		probably null	Het
Pfkp	C	A	13: 6,602,781	V434F	probably benign	Het
Phospho1	G	A	11: 95,830,906	R134H	probably damaging	Het
Polg2	G	T	11: 106,772,746	Q374K	probably benign	Het
Ptpra	T	C	2: 130,537,651		probably null	Het
Rassf3	C	T	10: 121,416,147	E120K	probably benign	Het
Reln	A	T	5: 22,106,097	S273T	probably damaging	Het
Scarb1	C	T	5: 125,284,025	A133T	probably benign	Het
Scn3a	T	A	2: 65,483,142	K1142N	probably damaging	Het
Sema3c	G	A	5: 17,694,703	V398I	probably benign	Het
Serpine1	C	A	5: 137,071,064	Q80H	probably damaging	Het
Sh3gl1	G	A	17: 56,017,646	T334M	probably damaging	Het
Smg7	T	C	1: 152,861,825	N122D	probably benign	Het
Speer4b	T	C	5: 27,498,710	I144V	probably benign	Het
Spire2	T	A	8: 123,369,250	D671E	probably benign	Het
Sspo	A	T	6: 48,501,095	H5144L	probably benign	Het
Sstr2	A	T	11: 113,625,353	Q366L	probably damaging	Het
Ssu72	T	C	4: 155,731,393	F98S	probably damaging	Het
Syde2	C	T	3: 146,007,115	Q1003*	probably null	Het
Tcf12	T	A	9: 71,883,103		probably null	Het
Tnfrsf22	A	T	7: 143,640,819	C124S	probably damaging	Het
Txlnb	A	T	10: 17,827,798	T235S	possibly damaging	Het
Uaca	T	C	9: 60,870,413	L694P	probably damaging	Het
Unc13a	T	A	8: 71,630,553	N1620Y	probably damaging	Het
Vmn2r10	C	T	5: 109,003,334	C138Y	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r28	T	A	7: 5,481,496	E568D	probably benign	Het
Vmn2r57	A	T	7: 41,448,471	H57Q	possibly damaging	Het
Vwa5b1	A	G	4: 138,581,612	S756P	probably benign	Het
Washc5	C	A	15: 59,352,501	E470*	probably null	Het
Xpot	A	T	10: 121,606,773	V508D	probably damaging	Het
Zfp616	A	T	11: 74,085,261	K785N	possibly damaging	Het
Zfp653	T	C	9: 22,065,899	N119D	probably damaging	Het
Zfp729b	A	G	13: 67,593,376	S257P	probably damaging	Het
Zfp82	T	A	7: 30,056,167	T497S	probably benign	Het
Znrf4	T	G	17: 56,512,305	M1L	probably benign	Het

Other mutations in Tapbp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tapbp	APN	17	33919892	missense	probably benign
IGL00229:Tapbp	APN	17	33925704	missense	probably damaging	1.00
R0002:Tapbp	UTSW	17	33925632	missense	probably damaging	0.98
R0416:Tapbp	UTSW	17	33925418	missense	probably damaging	0.99
R0800:Tapbp	UTSW	17	33926253	missense	probably benign	0.39
R0839:Tapbp	UTSW	17	33925743	missense	probably benign	0.00
R1584:Tapbp	UTSW	17	33919940	splice site	probably null
R1617:Tapbp	UTSW	17	33920431	missense	probably benign	0.06
R2214:Tapbp	UTSW	17	33920326	missense	possibly damaging	0.90
R3941:Tapbp	UTSW	17	33920483	missense	possibly damaging	0.91
R4570:Tapbp	UTSW	17	33926453	missense	probably damaging	1.00
R4571:Tapbp	UTSW	17	33926453	missense	probably damaging	1.00
R4935:Tapbp	UTSW	17	33925622	missense	probably benign	0.02
R6195:Tapbp	UTSW	17	33919982	missense	probably damaging	1.00
R6233:Tapbp	UTSW	17	33919982	missense	probably damaging	1.00
R6468:Tapbp	UTSW	17	33926098	missense	probably damaging	1.00
R6736:Tapbp	UTSW	17	33919957	missense	possibly damaging	0.85
R7139:Tapbp	UTSW	17	33920048	missense	possibly damaging	0.46
R7233:Tapbp	UTSW	17	33919969	missense	probably damaging	0.99
R7448:Tapbp	UTSW	17	33920417	missense	possibly damaging	0.70
R7630:Tapbp	UTSW	17	33920344	missense	probably benign	0.02
R8545:Tapbp	UTSW	17	33920317	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGGGCTGCAAACCTCTCATC -3'
(R):5'- CAAGCTGCAAATGCCGTAGC -3'

Sequencing Primer
(F):5'- ATTGTAAATGGATGTGTCCCTGAAGC -3'
(R):5'- AAATGCCGTAGCCTTTTCCTGG -3'

Posted On

2019-05-15