Incidental Mutation 'R7147:Sh3d19'
ID553856
Institutional Source Beutler Lab
Gene Symbol Sh3d19
Ensembl Gene ENSMUSG00000028082
Gene NameSH3 domain protein D19
SynonymsKryn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7147 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location85971109-86130526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86104277 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 390 (I390N)
Ref Sequence ENSEMBL: ENSMUSP00000103291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107664] [ENSMUST00000182666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107664
AA Change: I390N

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103291
Gene: ENSMUSG00000028082
AA Change: I390N

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182666
AA Change: I390N

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138320
Gene: ENSMUSG00000028082
AA Change: I390N

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,725 G303D probably damaging Het
Adgra3 C T 5: 49,961,245 G987D probably damaging Het
Akap11 A G 14: 78,511,465 S1161P Het
Ampd3 G A 7: 110,804,852 E528K probably damaging Het
Arl8b G A 6: 108,815,015 R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Cald1 A T 6: 34,746,296 Q105L Het
Casd1 T C 6: 4,624,187 Y327H probably benign Het
Chodl T A 16: 78,946,741 C239S probably damaging Het
D130043K22Rik A T 13: 24,882,563 H781L probably benign Het
Dlg1 A T 16: 31,791,854 M318L probably benign Het
Dlgap1 T C 17: 70,662,758 S520P probably benign Het
Dmxl2 T C 9: 54,416,729 I950V probably benign Het
Dnah17 T A 11: 118,094,929 T1441S probably benign Het
Dock7 A T 4: 98,961,417 N1638K unknown Het
Ect2 A T 3: 27,150,090 D23E probably benign Het
Ephx1 T A 1: 181,001,819 T55S probably damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fbxw27 A G 9: 109,789,323 probably null Het
Fhl5 T A 4: 25,213,777 probably null Het
Gm5145 G A 17: 20,571,061 E234K probably damaging Het
Gm5737 A T 7: 120,813,015 R33S probably damaging Het
Gpr39 G A 1: 125,872,501 D330N possibly damaging Het
Greb1 C T 12: 16,733,427 R102H probably damaging Het
Hist1h4m A G 13: 21,811,989 D69G probably damaging Het
Ighmbp2 T C 19: 3,271,676 K361R probably benign Het
Inpp4b A G 8: 81,902,771 D245G probably damaging Het
Ints14 T C 9: 64,983,985 V416A possibly damaging Het
Kif21a A G 15: 90,980,883 S529P probably benign Het
Limk1 A G 5: 134,657,341 M609T probably benign Het
Lrrc75a G A 11: 62,605,969 P256S probably damaging Het
Mcc T C 18: 44,493,513 R339G probably damaging Het
Mdga1 C T 17: 29,846,521 W371* probably null Het
Mei4 T A 9: 81,927,596 L244Q probably damaging Het
Mical2 C T 7: 112,323,603 P605L possibly damaging Het
Mrgprf G T 7: 145,308,391 R230L possibly damaging Het
Nlgn1 T A 3: 26,133,360 R125S probably benign Het
Olfr652 A G 7: 104,564,066 probably benign Het
Papola A T 12: 105,808,638 probably benign Het
Pold2 T C 11: 5,873,095 D360G probably benign Het
Prr12 T C 7: 45,033,850 R1797G unknown Het
Psmg2 C T 18: 67,653,268 P233S probably benign Het
Ptprh A G 7: 4,550,782 W857R probably damaging Het
Raet1e A T 10: 22,181,280 M168L probably benign Het
Rhbdl2 A T 4: 123,810,115 Y61F probably damaging Het
Sacm1l A G 9: 123,568,951 N236S probably damaging Het
Sbf2 A T 7: 110,447,061 S310T probably benign Het
Slco3a1 A G 7: 74,504,294 Y177H probably damaging Het
Smo G A 6: 29,758,449 G531D possibly damaging Het
Snx25 A C 8: 46,105,196 V258G probably damaging Het
Spata31d1b T A 13: 59,718,214 S1059T probably benign Het
Srgap2 C T 1: 131,310,594 C274Y Het
Srrm1 A G 4: 135,346,826 I48T probably damaging Het
Syne1 A T 10: 5,249,340 V3719E probably damaging Het
Tcerg1 T A 18: 42,550,063 M616K probably benign Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Tie1 A T 4: 118,484,413 V234D probably damaging Het
Tom1 A G 8: 75,057,267 N293S probably damaging Het
Trim13 A T 14: 61,604,631 K32N probably damaging Het
Trim6 G A 7: 104,225,570 V5I probably benign Het
Vps11 A T 9: 44,355,082 L436* probably null Het
Vps50 C T 6: 3,567,750 Q549* probably null Het
Vtcn1 T A 3: 100,883,894 F83I probably damaging Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Zfp758 A T 17: 22,376,000 Y489F possibly damaging Het
Zfp804a T C 2: 82,258,187 Y787H probably benign Het
Zfp9 C T 6: 118,465,002 C233Y probably damaging Het
Other mutations in Sh3d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Sh3d19 APN 3 86098185 missense probably benign 0.01
IGL01483:Sh3d19 APN 3 86114796 missense probably benign 0.09
IGL02272:Sh3d19 APN 3 86121167 missense probably benign 0.02
IGL02308:Sh3d19 APN 3 86093710 missense probably damaging 0.98
IGL02431:Sh3d19 APN 3 86106998 missense probably damaging 1.00
R0277:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0323:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0624:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R0639:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R0673:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1569:Sh3d19 UTSW 3 86126644 missense possibly damaging 0.83
R1738:Sh3d19 UTSW 3 86120606 missense probably damaging 1.00
R3911:Sh3d19 UTSW 3 86107227 missense possibly damaging 0.62
R3913:Sh3d19 UTSW 3 86084776 missense probably damaging 0.97
R4246:Sh3d19 UTSW 3 86126688 missense probably benign 0.06
R4327:Sh3d19 UTSW 3 86123713 missense probably benign
R4663:Sh3d19 UTSW 3 86123263 missense probably benign 0.06
R4730:Sh3d19 UTSW 3 86116864 missense possibly damaging 0.89
R4812:Sh3d19 UTSW 3 86123767 missense probably damaging 1.00
R4841:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R4842:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R5814:Sh3d19 UTSW 3 86126604 missense probably benign 0.00
R6279:Sh3d19 UTSW 3 86104102 missense possibly damaging 0.77
R6504:Sh3d19 UTSW 3 86085336 missense probably benign
R6806:Sh3d19 UTSW 3 86104333 missense probably damaging 0.99
R6916:Sh3d19 UTSW 3 86084911 missense probably benign 0.03
R7012:Sh3d19 UTSW 3 86085013 missense probably benign 0.01
R7367:Sh3d19 UTSW 3 86104228 missense probably benign 0.21
R7590:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
X0027:Sh3d19 UTSW 3 86120703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTGTACATGGAAAAGTCATTC -3'
(R):5'- CTAAAGCTTTCTGGGCCAGG -3'

Sequencing Primer
(F):5'- ATTCCAGTTTGGAGGCCT -3'
(R):5'- TCTACAGAGTGAGTTCCAGGAC -3'
Posted On2019-05-15