Incidental Mutation 'R7147:Vtcn1'
ID 553857
Institutional Source Beutler Lab
Gene Symbol Vtcn1
Ensembl Gene ENSMUSG00000051076
Gene Name V-set domain containing T cell activation inhibitor 1
Synonyms B7-H4, B7x
MMRRC Submission 045224-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R7147 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 100732775-100804238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100791210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 83 (F83I)
Ref Sequence ENSEMBL: ENSMUSP00000057721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054791]
AlphaFold Q7TSP5
Predicted Effect probably damaging
Transcript: ENSMUST00000054791
AA Change: F83I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057721
Gene: ENSMUSG00000051076
AA Change: F83I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
IG 41 146 3.13e-5 SMART
Blast:IG_like 153 243 5e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for this mutation display stronger Th1 responses upon parasitic infection by L. major including reduced footpad swelling and lower parasite burden compared to controls. Responses to other Th1-driven immune responses are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 56,017,182 (GRCm39) G303D probably damaging Het
Adgra3 C T 5: 50,118,587 (GRCm39) G987D probably damaging Het
Akap11 A G 14: 78,748,905 (GRCm39) S1161P Het
Ampd3 G A 7: 110,404,059 (GRCm39) E528K probably damaging Het
Arl8b G A 6: 108,791,976 (GRCm39) R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,141,500 (GRCm39) probably benign Het
Cald1 A T 6: 34,723,231 (GRCm39) Q105L Het
Casd1 T C 6: 4,624,187 (GRCm39) Y327H probably benign Het
Chodl T A 16: 78,743,629 (GRCm39) C239S probably damaging Het
D130043K22Rik A T 13: 25,066,546 (GRCm39) H781L probably benign Het
Dlg1 A T 16: 31,610,672 (GRCm39) M318L probably benign Het
Dlgap1 T C 17: 70,969,753 (GRCm39) S520P probably benign Het
Dmxl2 T C 9: 54,324,013 (GRCm39) I950V probably benign Het
Dnah17 T A 11: 117,985,755 (GRCm39) T1441S probably benign Het
Dock7 A T 4: 98,849,654 (GRCm39) N1638K unknown Het
Ect2 A T 3: 27,204,239 (GRCm39) D23E probably benign Het
Ephx1 T A 1: 180,829,384 (GRCm39) T55S probably damaging Het
F11 T C 8: 45,703,183 (GRCm39) Y169C probably damaging Het
Fbxw27 A G 9: 109,618,391 (GRCm39) probably null Het
Fhl5 T A 4: 25,213,777 (GRCm39) probably null Het
Gm5145 G A 17: 20,791,323 (GRCm39) E234K probably damaging Het
Gpr39 G A 1: 125,800,238 (GRCm39) D330N possibly damaging Het
Greb1 C T 12: 16,783,428 (GRCm39) R102H probably damaging Het
H4c17 A G 13: 21,996,159 (GRCm39) D69G probably damaging Het
Ighmbp2 T C 19: 3,321,676 (GRCm39) K361R probably benign Het
Inpp4b A G 8: 82,629,400 (GRCm39) D245G probably damaging Het
Ints14 T C 9: 64,891,267 (GRCm39) V416A possibly damaging Het
Kif21a A G 15: 90,865,086 (GRCm39) S529P probably benign Het
Limk1 A G 5: 134,686,195 (GRCm39) M609T probably benign Het
Lrrc75a G A 11: 62,496,795 (GRCm39) P256S probably damaging Het
Mcc T C 18: 44,626,580 (GRCm39) R339G probably damaging Het
Mdga1 C T 17: 30,065,495 (GRCm39) W371* probably null Het
Mei4 T A 9: 81,809,649 (GRCm39) L244Q probably damaging Het
Mical2 C T 7: 111,922,810 (GRCm39) P605L possibly damaging Het
Mrgprf G T 7: 144,862,128 (GRCm39) R230L possibly damaging Het
Nlgn1 T A 3: 26,187,509 (GRCm39) R125S probably benign Het
Or52h7 A G 7: 104,213,273 (GRCm39) probably benign Het
Papola A T 12: 105,774,897 (GRCm39) probably benign Het
Pold2 T C 11: 5,823,095 (GRCm39) D360G probably benign Het
Prr12 T C 7: 44,683,274 (GRCm39) R1797G unknown Het
Psmg2 C T 18: 67,786,338 (GRCm39) P233S probably benign Het
Ptprh A G 7: 4,553,781 (GRCm39) W857R probably damaging Het
Raet1e A T 10: 22,057,179 (GRCm39) M168L probably benign Het
Rhbdl2 A T 4: 123,703,908 (GRCm39) Y61F probably damaging Het
Sacm1l A G 9: 123,398,016 (GRCm39) N236S probably damaging Het
Sbf2 A T 7: 110,046,268 (GRCm39) S310T probably benign Het
Sdr42e2 A T 7: 120,412,238 (GRCm39) R33S probably damaging Het
Sh3d19 T A 3: 86,011,584 (GRCm39) I390N possibly damaging Het
Slco3a1 A G 7: 74,154,042 (GRCm39) Y177H probably damaging Het
Smo G A 6: 29,758,448 (GRCm39) G531D possibly damaging Het
Snx25 A C 8: 46,558,233 (GRCm39) V258G probably damaging Het
Spata31d1b T A 13: 59,866,028 (GRCm39) S1059T probably benign Het
Srgap2 C T 1: 131,238,332 (GRCm39) C274Y Het
Srrm1 A G 4: 135,074,137 (GRCm39) I48T probably damaging Het
Syne1 A T 10: 5,199,340 (GRCm39) V3719E probably damaging Het
Tcerg1 T A 18: 42,683,128 (GRCm39) M616K probably benign Het
Tgtp2 G C 11: 48,950,135 (GRCm39) R146G probably damaging Het
Tie1 A T 4: 118,341,610 (GRCm39) V234D probably damaging Het
Tom1 A G 8: 75,783,895 (GRCm39) N293S probably damaging Het
Trim13 A T 14: 61,842,080 (GRCm39) K32N probably damaging Het
Trim6 G A 7: 103,874,777 (GRCm39) V5I probably benign Het
Vps11 A T 9: 44,266,379 (GRCm39) L436* probably null Het
Vps50 C T 6: 3,567,750 (GRCm39) Q549* probably null Het
Zfp131 T C 13: 120,228,079 (GRCm39) T523A probably benign Het
Zfp758 A T 17: 22,594,981 (GRCm39) Y489F possibly damaging Het
Zfp804a T C 2: 82,088,531 (GRCm39) Y787H probably benign Het
Zfp9 C T 6: 118,441,963 (GRCm39) C233Y probably damaging Het
Other mutations in Vtcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Vtcn1 APN 3 100,795,663 (GRCm39) missense probably damaging 1.00
IGL02376:Vtcn1 APN 3 100,799,981 (GRCm39) missense probably benign 0.05
IGL02833:Vtcn1 APN 3 100,795,701 (GRCm39) missense probably damaging 1.00
IGL02876:Vtcn1 APN 3 100,791,145 (GRCm39) missense probably damaging 0.97
IGL03018:Vtcn1 APN 3 100,791,226 (GRCm39) missense probably damaging 0.98
R2431:Vtcn1 UTSW 3 100,732,893 (GRCm39) missense possibly damaging 0.53
R4194:Vtcn1 UTSW 3 100,795,525 (GRCm39) missense probably damaging 0.97
R4881:Vtcn1 UTSW 3 100,799,909 (GRCm39) missense probably benign
R6916:Vtcn1 UTSW 3 100,795,479 (GRCm39) critical splice acceptor site probably null
R7739:Vtcn1 UTSW 3 100,791,211 (GRCm39) missense probably damaging 1.00
R8365:Vtcn1 UTSW 3 100,791,145 (GRCm39) missense probably benign 0.15
R8395:Vtcn1 UTSW 3 100,791,070 (GRCm39) missense probably benign
R9172:Vtcn1 UTSW 3 100,799,865 (GRCm39) missense probably benign 0.00
R9236:Vtcn1 UTSW 3 100,795,533 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AACATGGCTGCCCAAGTACC -3'
(R):5'- CCTCCGGTCTTATACTCAAGGTTTG -3'

Sequencing Primer
(F):5'- AAGTACCAGGGCCTCACTG -3'
(R):5'- GGTCTTATACTCAAGGTTTGCATTC -3'
Posted On 2019-05-15