Incidental Mutation 'R7147:Vtcn1'
ID553857
Institutional Source Beutler Lab
Gene Symbol Vtcn1
Ensembl Gene ENSMUSG00000051076
Gene NameV-set domain containing T cell activation inhibitor 1
SynonymsB7x, B7-H4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7147 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location100825459-100896922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100883894 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 83 (F83I)
Ref Sequence ENSEMBL: ENSMUSP00000057721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054791]
Predicted Effect probably damaging
Transcript: ENSMUST00000054791
AA Change: F83I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057721
Gene: ENSMUSG00000051076
AA Change: F83I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
IG 41 146 3.13e-5 SMART
Blast:IG_like 153 243 5e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the B7 costimulatory protein family. Proteins in this family are present on the surface of antigen-presenting cells and interact with ligand bound to receptors on the surface of T cells. Studies have shown that high levels of the encoded protein has been correlated with tumor progression. A pseudogene of this gene is located on chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for this mutation display stronger Th1 responses upon parasitic infection by L. major including reduced footpad swelling and lower parasite burden compared to controls. Responses to other Th1-driven immune responses are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,725 G303D probably damaging Het
Adgra3 C T 5: 49,961,245 G987D probably damaging Het
Akap11 A G 14: 78,511,465 S1161P Het
Ampd3 G A 7: 110,804,852 E528K probably damaging Het
Arl8b G A 6: 108,815,015 R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Cald1 A T 6: 34,746,296 Q105L Het
Casd1 T C 6: 4,624,187 Y327H probably benign Het
Chodl T A 16: 78,946,741 C239S probably damaging Het
D130043K22Rik A T 13: 24,882,563 H781L probably benign Het
Dlg1 A T 16: 31,791,854 M318L probably benign Het
Dlgap1 T C 17: 70,662,758 S520P probably benign Het
Dmxl2 T C 9: 54,416,729 I950V probably benign Het
Dnah17 T A 11: 118,094,929 T1441S probably benign Het
Dock7 A T 4: 98,961,417 N1638K unknown Het
Ect2 A T 3: 27,150,090 D23E probably benign Het
Ephx1 T A 1: 181,001,819 T55S probably damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fbxw27 A G 9: 109,789,323 probably null Het
Fhl5 T A 4: 25,213,777 probably null Het
Gm5145 G A 17: 20,571,061 E234K probably damaging Het
Gm5737 A T 7: 120,813,015 R33S probably damaging Het
Gpr39 G A 1: 125,872,501 D330N possibly damaging Het
Greb1 C T 12: 16,733,427 R102H probably damaging Het
Hist1h4m A G 13: 21,811,989 D69G probably damaging Het
Ighmbp2 T C 19: 3,271,676 K361R probably benign Het
Inpp4b A G 8: 81,902,771 D245G probably damaging Het
Ints14 T C 9: 64,983,985 V416A possibly damaging Het
Kif21a A G 15: 90,980,883 S529P probably benign Het
Limk1 A G 5: 134,657,341 M609T probably benign Het
Lrrc75a G A 11: 62,605,969 P256S probably damaging Het
Mcc T C 18: 44,493,513 R339G probably damaging Het
Mdga1 C T 17: 29,846,521 W371* probably null Het
Mei4 T A 9: 81,927,596 L244Q probably damaging Het
Mical2 C T 7: 112,323,603 P605L possibly damaging Het
Mrgprf G T 7: 145,308,391 R230L possibly damaging Het
Nlgn1 T A 3: 26,133,360 R125S probably benign Het
Olfr652 A G 7: 104,564,066 probably benign Het
Papola A T 12: 105,808,638 probably benign Het
Pold2 T C 11: 5,873,095 D360G probably benign Het
Prr12 T C 7: 45,033,850 R1797G unknown Het
Psmg2 C T 18: 67,653,268 P233S probably benign Het
Ptprh A G 7: 4,550,782 W857R probably damaging Het
Raet1e A T 10: 22,181,280 M168L probably benign Het
Rhbdl2 A T 4: 123,810,115 Y61F probably damaging Het
Sacm1l A G 9: 123,568,951 N236S probably damaging Het
Sbf2 A T 7: 110,447,061 S310T probably benign Het
Sh3d19 T A 3: 86,104,277 I390N possibly damaging Het
Slco3a1 A G 7: 74,504,294 Y177H probably damaging Het
Smo G A 6: 29,758,449 G531D possibly damaging Het
Snx25 A C 8: 46,105,196 V258G probably damaging Het
Spata31d1b T A 13: 59,718,214 S1059T probably benign Het
Srgap2 C T 1: 131,310,594 C274Y Het
Srrm1 A G 4: 135,346,826 I48T probably damaging Het
Syne1 A T 10: 5,249,340 V3719E probably damaging Het
Tcerg1 T A 18: 42,550,063 M616K probably benign Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Tie1 A T 4: 118,484,413 V234D probably damaging Het
Tom1 A G 8: 75,057,267 N293S probably damaging Het
Trim13 A T 14: 61,604,631 K32N probably damaging Het
Trim6 G A 7: 104,225,570 V5I probably benign Het
Vps11 A T 9: 44,355,082 L436* probably null Het
Vps50 C T 6: 3,567,750 Q549* probably null Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Zfp758 A T 17: 22,376,000 Y489F possibly damaging Het
Zfp804a T C 2: 82,258,187 Y787H probably benign Het
Zfp9 C T 6: 118,465,002 C233Y probably damaging Het
Other mutations in Vtcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Vtcn1 APN 3 100888347 missense probably damaging 1.00
IGL02376:Vtcn1 APN 3 100892665 missense probably benign 0.05
IGL02833:Vtcn1 APN 3 100888385 missense probably damaging 1.00
IGL02876:Vtcn1 APN 3 100883829 missense probably damaging 0.97
IGL03018:Vtcn1 APN 3 100883910 missense probably damaging 0.98
R2431:Vtcn1 UTSW 3 100825577 missense possibly damaging 0.53
R4194:Vtcn1 UTSW 3 100888209 missense probably damaging 0.97
R4881:Vtcn1 UTSW 3 100892593 missense probably benign
R6916:Vtcn1 UTSW 3 100888163 critical splice acceptor site probably null
R7739:Vtcn1 UTSW 3 100883895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGGCTGCCCAAGTACC -3'
(R):5'- CCTCCGGTCTTATACTCAAGGTTTG -3'

Sequencing Primer
(F):5'- AAGTACCAGGGCCTCACTG -3'
(R):5'- GGTCTTATACTCAAGGTTTGCATTC -3'
Posted On2019-05-15