Incidental Mutation 'R7147:D130043K22Rik'
ID 553900
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7147 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24882563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 781 (H781L)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably benign
Transcript: ENSMUST00000006893
AA Change: H781L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: H781L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,725 G303D probably damaging Het
Adgra3 C T 5: 49,961,245 G987D probably damaging Het
Akap11 A G 14: 78,511,465 S1161P Het
Ampd3 G A 7: 110,804,852 E528K probably damaging Het
Arl8b G A 6: 108,815,015 R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Cald1 A T 6: 34,746,296 Q105L Het
Casd1 T C 6: 4,624,187 Y327H probably benign Het
Chodl T A 16: 78,946,741 C239S probably damaging Het
Dlg1 A T 16: 31,791,854 M318L probably benign Het
Dlgap1 T C 17: 70,662,758 S520P probably benign Het
Dmxl2 T C 9: 54,416,729 I950V probably benign Het
Dnah17 T A 11: 118,094,929 T1441S probably benign Het
Dock7 A T 4: 98,961,417 N1638K unknown Het
Ect2 A T 3: 27,150,090 D23E probably benign Het
Ephx1 T A 1: 181,001,819 T55S probably damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fbxw27 A G 9: 109,789,323 probably null Het
Fhl5 T A 4: 25,213,777 probably null Het
Gm5145 G A 17: 20,571,061 E234K probably damaging Het
Gm5737 A T 7: 120,813,015 R33S probably damaging Het
Gpr39 G A 1: 125,872,501 D330N possibly damaging Het
Greb1 C T 12: 16,733,427 R102H probably damaging Het
Hist1h4m A G 13: 21,811,989 D69G probably damaging Het
Ighmbp2 T C 19: 3,271,676 K361R probably benign Het
Inpp4b A G 8: 81,902,771 D245G probably damaging Het
Ints14 T C 9: 64,983,985 V416A possibly damaging Het
Kif21a A G 15: 90,980,883 S529P probably benign Het
Limk1 A G 5: 134,657,341 M609T probably benign Het
Lrrc75a G A 11: 62,605,969 P256S probably damaging Het
Mcc T C 18: 44,493,513 R339G probably damaging Het
Mdga1 C T 17: 29,846,521 W371* probably null Het
Mei4 T A 9: 81,927,596 L244Q probably damaging Het
Mical2 C T 7: 112,323,603 P605L possibly damaging Het
Mrgprf G T 7: 145,308,391 R230L possibly damaging Het
Nlgn1 T A 3: 26,133,360 R125S probably benign Het
Olfr652 A G 7: 104,564,066 probably benign Het
Papola A T 12: 105,808,638 probably benign Het
Pold2 T C 11: 5,873,095 D360G probably benign Het
Prr12 T C 7: 45,033,850 R1797G unknown Het
Psmg2 C T 18: 67,653,268 P233S probably benign Het
Ptprh A G 7: 4,550,782 W857R probably damaging Het
Raet1e A T 10: 22,181,280 M168L probably benign Het
Rhbdl2 A T 4: 123,810,115 Y61F probably damaging Het
Sacm1l A G 9: 123,568,951 N236S probably damaging Het
Sbf2 A T 7: 110,447,061 S310T probably benign Het
Sh3d19 T A 3: 86,104,277 I390N possibly damaging Het
Slco3a1 A G 7: 74,504,294 Y177H probably damaging Het
Smo G A 6: 29,758,449 G531D possibly damaging Het
Snx25 A C 8: 46,105,196 V258G probably damaging Het
Spata31d1b T A 13: 59,718,214 S1059T probably benign Het
Srgap2 C T 1: 131,310,594 C274Y Het
Srrm1 A G 4: 135,346,826 I48T probably damaging Het
Syne1 A T 10: 5,249,340 V3719E probably damaging Het
Tcerg1 T A 18: 42,550,063 M616K probably benign Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Tie1 A T 4: 118,484,413 V234D probably damaging Het
Tom1 A G 8: 75,057,267 N293S probably damaging Het
Trim13 A T 14: 61,604,631 K32N probably damaging Het
Trim6 G A 7: 104,225,570 V5I probably benign Het
Vps11 A T 9: 44,355,082 L436* probably null Het
Vps50 C T 6: 3,567,750 Q549* probably null Het
Vtcn1 T A 3: 100,883,894 F83I probably damaging Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Zfp758 A T 17: 22,376,000 Y489F possibly damaging Het
Zfp804a T C 2: 82,258,187 Y787H probably benign Het
Zfp9 C T 6: 118,465,002 C233Y probably damaging Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAAAGTTCAGTTTACTGC -3'
(R):5'- ATTGGCCAAGAGCAGAAGCC -3'

Sequencing Primer
(F):5'- GATTCAAAAATCTCAGCCCTGCTC -3'
(R):5'- CAGAAGCCAGGCACAGATG -3'
Posted On 2019-05-15