Incidental Mutation 'R7147:Spata31d1b'
ID553901
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Namespermatogenesis associated 31 subfamily D, member 1B
SynonymsFam75d1b, Gm4934
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7147 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location59712284-59719295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59718214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1059 (S1059T)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
Predicted Effect probably benign
Transcript: ENSMUST00000165133
AA Change: S1059T

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: S1059T

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,725 G303D probably damaging Het
Adgra3 C T 5: 49,961,245 G987D probably damaging Het
Akap11 A G 14: 78,511,465 S1161P Het
Ampd3 G A 7: 110,804,852 E528K probably damaging Het
Arl8b G A 6: 108,815,015 R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Cald1 A T 6: 34,746,296 Q105L Het
Casd1 T C 6: 4,624,187 Y327H probably benign Het
Chodl T A 16: 78,946,741 C239S probably damaging Het
D130043K22Rik A T 13: 24,882,563 H781L probably benign Het
Dlg1 A T 16: 31,791,854 M318L probably benign Het
Dlgap1 T C 17: 70,662,758 S520P probably benign Het
Dmxl2 T C 9: 54,416,729 I950V probably benign Het
Dnah17 T A 11: 118,094,929 T1441S probably benign Het
Dock7 A T 4: 98,961,417 N1638K unknown Het
Ect2 A T 3: 27,150,090 D23E probably benign Het
Ephx1 T A 1: 181,001,819 T55S probably damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fbxw27 A G 9: 109,789,323 probably null Het
Fhl5 T A 4: 25,213,777 probably null Het
Gm5145 G A 17: 20,571,061 E234K probably damaging Het
Gm5737 A T 7: 120,813,015 R33S probably damaging Het
Gpr39 G A 1: 125,872,501 D330N possibly damaging Het
Greb1 C T 12: 16,733,427 R102H probably damaging Het
Hist1h4m A G 13: 21,811,989 D69G probably damaging Het
Ighmbp2 T C 19: 3,271,676 K361R probably benign Het
Inpp4b A G 8: 81,902,771 D245G probably damaging Het
Ints14 T C 9: 64,983,985 V416A possibly damaging Het
Kif21a A G 15: 90,980,883 S529P probably benign Het
Limk1 A G 5: 134,657,341 M609T probably benign Het
Lrrc75a G A 11: 62,605,969 P256S probably damaging Het
Mcc T C 18: 44,493,513 R339G probably damaging Het
Mdga1 C T 17: 29,846,521 W371* probably null Het
Mei4 T A 9: 81,927,596 L244Q probably damaging Het
Mical2 C T 7: 112,323,603 P605L possibly damaging Het
Mrgprf G T 7: 145,308,391 R230L possibly damaging Het
Nlgn1 T A 3: 26,133,360 R125S probably benign Het
Olfr652 A G 7: 104,564,066 probably benign Het
Papola A T 12: 105,808,638 probably benign Het
Pold2 T C 11: 5,873,095 D360G probably benign Het
Prr12 T C 7: 45,033,850 R1797G unknown Het
Psmg2 C T 18: 67,653,268 P233S probably benign Het
Ptprh A G 7: 4,550,782 W857R probably damaging Het
Raet1e A T 10: 22,181,280 M168L probably benign Het
Rhbdl2 A T 4: 123,810,115 Y61F probably damaging Het
Sacm1l A G 9: 123,568,951 N236S probably damaging Het
Sbf2 A T 7: 110,447,061 S310T probably benign Het
Sh3d19 T A 3: 86,104,277 I390N possibly damaging Het
Slco3a1 A G 7: 74,504,294 Y177H probably damaging Het
Smo G A 6: 29,758,449 G531D possibly damaging Het
Snx25 A C 8: 46,105,196 V258G probably damaging Het
Srgap2 C T 1: 131,310,594 C274Y Het
Srrm1 A G 4: 135,346,826 I48T probably damaging Het
Syne1 A T 10: 5,249,340 V3719E probably damaging Het
Tcerg1 T A 18: 42,550,063 M616K probably benign Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Tie1 A T 4: 118,484,413 V234D probably damaging Het
Tom1 A G 8: 75,057,267 N293S probably damaging Het
Trim13 A T 14: 61,604,631 K32N probably damaging Het
Trim6 G A 7: 104,225,570 V5I probably benign Het
Vps11 A T 9: 44,355,082 L436* probably null Het
Vps50 C T 6: 3,567,750 Q549* probably null Het
Vtcn1 T A 3: 100,883,894 F83I probably damaging Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Zfp758 A T 17: 22,376,000 Y489F possibly damaging Het
Zfp804a T C 2: 82,258,187 Y787H probably benign Het
Zfp9 C T 6: 118,465,002 C233Y probably damaging Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59712466 missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59718040 missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59719127 utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59716069 missense probably benign
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59716277 missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59717804 missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59717518 missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59716654 missense probably benign
R1338:Spata31d1b UTSW 13 59718161 frame shift probably null
R1539:Spata31d1b UTSW 13 59715919 missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59716628 missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59715460 missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59716567 missense probably benign
R1793:Spata31d1b UTSW 13 59715965 missense probably benign
R1838:Spata31d1b UTSW 13 59715857 missense probably benign
R1838:Spata31d1b UTSW 13 59717465 missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59717336 missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59718068 missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59718021 missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59716380 missense probably benign
R1995:Spata31d1b UTSW 13 59716380 missense probably benign
R2407:Spata31d1b UTSW 13 59716846 missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59717891 missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59716861 missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59716612 missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59718355 missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59717103 missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59716283 missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59716024 missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59716495 missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59718218 missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59719052 missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59716672 missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59718973 missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59715650 missense probably benign
R6433:Spata31d1b UTSW 13 59717185 missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59717455 missense probably benign
R6980:Spata31d1b UTSW 13 59715422 missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59712435 missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59716141 missense probably benign
R7273:Spata31d1b UTSW 13 59717632 missense probably benign
R7359:Spata31d1b UTSW 13 59712490 missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59716909 missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59715464 missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59716912 missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59716654 missense probably benign
R7586:Spata31d1b UTSW 13 59718380 missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59715763 missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R7824:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCCACAGAGCTACACAAGGG -3'
(R):5'- GGGAGACAGTCCTTGTTCTTGC -3'

Sequencing Primer
(F):5'- GAGAGCAACTCCCGGGTCTTC -3'
(R):5'- CTCTTGCCTGAGACATATGCAGG -3'
Posted On2019-05-15