Incidental Mutation 'R7147:Tcerg1'
ID553914
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Nametranscription elongation regulator 1 (CA150)
SynonymsTaf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7147 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location42511510-42575551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42550063 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 616 (M616K)
Ref Sequence ENSEMBL: ENSMUSP00000025375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
PDB Structure
FBP28WW DOMAIN FROM MUS MUSCULUS [SOLUTION NMR]
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Solution structure of the first WW domain from the mouse transcription elongation regulator 1, transcription factor CA150 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000025375
AA Change: M616K

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: M616K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173642
AA Change: M616K
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498
AA Change: M616K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,725 G303D probably damaging Het
Adgra3 C T 5: 49,961,245 G987D probably damaging Het
Akap11 A G 14: 78,511,465 S1161P Het
Ampd3 G A 7: 110,804,852 E528K probably damaging Het
Arl8b G A 6: 108,815,015 R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Cald1 A T 6: 34,746,296 Q105L Het
Casd1 T C 6: 4,624,187 Y327H probably benign Het
Chodl T A 16: 78,946,741 C239S probably damaging Het
D130043K22Rik A T 13: 24,882,563 H781L probably benign Het
Dlg1 A T 16: 31,791,854 M318L probably benign Het
Dlgap1 T C 17: 70,662,758 S520P probably benign Het
Dmxl2 T C 9: 54,416,729 I950V probably benign Het
Dnah17 T A 11: 118,094,929 T1441S probably benign Het
Dock7 A T 4: 98,961,417 N1638K unknown Het
Ect2 A T 3: 27,150,090 D23E probably benign Het
Ephx1 T A 1: 181,001,819 T55S probably damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fbxw27 A G 9: 109,789,323 probably null Het
Fhl5 T A 4: 25,213,777 probably null Het
Gm5145 G A 17: 20,571,061 E234K probably damaging Het
Gm5737 A T 7: 120,813,015 R33S probably damaging Het
Gpr39 G A 1: 125,872,501 D330N possibly damaging Het
Greb1 C T 12: 16,733,427 R102H probably damaging Het
Hist1h4m A G 13: 21,811,989 D69G probably damaging Het
Ighmbp2 T C 19: 3,271,676 K361R probably benign Het
Inpp4b A G 8: 81,902,771 D245G probably damaging Het
Ints14 T C 9: 64,983,985 V416A possibly damaging Het
Kif21a A G 15: 90,980,883 S529P probably benign Het
Limk1 A G 5: 134,657,341 M609T probably benign Het
Lrrc75a G A 11: 62,605,969 P256S probably damaging Het
Mcc T C 18: 44,493,513 R339G probably damaging Het
Mdga1 C T 17: 29,846,521 W371* probably null Het
Mei4 T A 9: 81,927,596 L244Q probably damaging Het
Mical2 C T 7: 112,323,603 P605L possibly damaging Het
Mrgprf G T 7: 145,308,391 R230L possibly damaging Het
Nlgn1 T A 3: 26,133,360 R125S probably benign Het
Olfr652 A G 7: 104,564,066 probably benign Het
Papola A T 12: 105,808,638 probably benign Het
Pold2 T C 11: 5,873,095 D360G probably benign Het
Prr12 T C 7: 45,033,850 R1797G unknown Het
Psmg2 C T 18: 67,653,268 P233S probably benign Het
Ptprh A G 7: 4,550,782 W857R probably damaging Het
Raet1e A T 10: 22,181,280 M168L probably benign Het
Rhbdl2 A T 4: 123,810,115 Y61F probably damaging Het
Sacm1l A G 9: 123,568,951 N236S probably damaging Het
Sbf2 A T 7: 110,447,061 S310T probably benign Het
Sh3d19 T A 3: 86,104,277 I390N possibly damaging Het
Slco3a1 A G 7: 74,504,294 Y177H probably damaging Het
Smo G A 6: 29,758,449 G531D possibly damaging Het
Snx25 A C 8: 46,105,196 V258G probably damaging Het
Spata31d1b T A 13: 59,718,214 S1059T probably benign Het
Srgap2 C T 1: 131,310,594 C274Y Het
Srrm1 A G 4: 135,346,826 I48T probably damaging Het
Syne1 A T 10: 5,249,340 V3719E probably damaging Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Tie1 A T 4: 118,484,413 V234D probably damaging Het
Tom1 A G 8: 75,057,267 N293S probably damaging Het
Trim13 A T 14: 61,604,631 K32N probably damaging Het
Trim6 G A 7: 104,225,570 V5I probably benign Het
Vps11 A T 9: 44,355,082 L436* probably null Het
Vps50 C T 6: 3,567,750 Q549* probably null Het
Vtcn1 T A 3: 100,883,894 F83I probably damaging Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Zfp758 A T 17: 22,376,000 Y489F possibly damaging Het
Zfp804a T C 2: 82,258,187 Y787H probably benign Het
Zfp9 C T 6: 118,465,002 C233Y probably damaging Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42536342 missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42571125 missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42568453 missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42573309 missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42524277 missense unknown
IGL01832:Tcerg1 APN 18 42574555 missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42530656 missense unknown
IGL02937:Tcerg1 APN 18 42524349 missense unknown
IGL02953:Tcerg1 APN 18 42548470 missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42573357 missense probably damaging 1.00
tarantula UTSW 18 42536348 missense probably damaging 0.98
P0031:Tcerg1 UTSW 18 42573302 missense probably benign 0.07
R0060:Tcerg1 UTSW 18 42524008 missense unknown
R0138:Tcerg1 UTSW 18 42568614 splice site probably benign
R0482:Tcerg1 UTSW 18 42564240 splice site probably benign
R0502:Tcerg1 UTSW 18 42522956 missense unknown
R0731:Tcerg1 UTSW 18 42571840 missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42574652 missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42553430 missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42524292 missense unknown
R1673:Tcerg1 UTSW 18 42552581 missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42524349 missense unknown
R1799:Tcerg1 UTSW 18 42560947 missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42564145 missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42524244 missense unknown
R2989:Tcerg1 UTSW 18 42519475 missense unknown
R3831:Tcerg1 UTSW 18 42568489 missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42564136 frame shift probably null
R4034:Tcerg1 UTSW 18 42519533 missense unknown
R4826:Tcerg1 UTSW 18 42535115 missense unknown
R4858:Tcerg1 UTSW 18 42523981 missense unknown
R5371:Tcerg1 UTSW 18 42519535 missense unknown
R5865:Tcerg1 UTSW 18 42536348 missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42511498 unclassified probably null
R6258:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42530892 critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42548477 missense probably damaging 0.98
R7714:Tcerg1 UTSW 18 42560935 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCGCAAGTGAGTGACATGAC -3'
(R):5'- TTTTAAGGACAGACAACACCATCTC -3'

Sequencing Primer
(F):5'- TGACTGTAAACGGCACCTCTCATG -3'
(R):5'- TCAGGTCCAAGAAAGAAATTATGAC -3'
Posted On2019-05-15