Incidental Mutation 'R7148:Lamc2'
ID553921
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R7148 (G1)
Quality Score211.009
Status Not validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153185984 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2 (P2S)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
Predicted Effect probably benign
Transcript: ENSMUST00000027753
AA Change: P2S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: P2S

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185356
AA Change: P2S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: P2S

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0279:Lamc2 UTSW 1 153130696 missense probably benign 0.01
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153152082 missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1631:Lamc2 UTSW 1 153158934 missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2107:Lamc2 UTSW 1 153154386 splice site probably benign
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R3772:Lamc2 UTSW 1 153124251 missense probably benign
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7171:Lamc2 UTSW 1 153139749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTAGAGCGCGACTGTACAGG -3'
(R):5'- CCTCCTTGTTCACAGGTGAG -3'

Sequencing Primer
(F):5'- AGATAGGCTCTTTGCAGATCC -3'
(R):5'- CCTTGTTCACAGGTGAGTCACG -3'
Posted On2019-05-15