Incidental Mutation 'R7148:Kmo'
ID553923
Institutional Source Beutler Lab
Gene Symbol Kmo
Ensembl Gene ENSMUSG00000039783
Gene Namekynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175620381-175662116 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 175651602 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 235 (C235S)
Ref Sequence ENSEMBL: ENSMUSP00000038914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect probably damaging
Transcript: ENSMUST00000040250
AA Change: C235S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783
AA Change: C235S

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097458
AA Change: C235S

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783
AA Change: C235S

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140474
AA Change: M249K
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783
AA Change: M249K

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack kynurenine 3-monooxygenase activity and altered levels of several tryptophan metabolites. Mice homozygous for another null allele exhibit increased LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Kmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Kmo APN 1 175655095 missense possibly damaging 0.54
IGL01734:Kmo APN 1 175655102 missense probably benign 0.00
IGL02415:Kmo APN 1 175649323 splice site probably benign
IGL02551:Kmo APN 1 175637919 missense probably damaging 1.00
IGL02866:Kmo APN 1 175653588 missense probably damaging 1.00
IGL03140:Kmo APN 1 175649220 missense probably damaging 1.00
R0613:Kmo UTSW 1 175637892 missense probably damaging 1.00
R0617:Kmo UTSW 1 175647190 missense possibly damaging 0.85
R0883:Kmo UTSW 1 175647140 missense possibly damaging 0.70
R1034:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1037:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1164:Kmo UTSW 1 175658559 missense probably benign 0.00
R1519:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1519:Kmo UTSW 1 175656802 missense probably damaging 1.00
R1712:Kmo UTSW 1 175656723 missense probably benign
R1796:Kmo UTSW 1 175637895 missense probably benign 0.00
R1938:Kmo UTSW 1 175651588 missense possibly damaging 0.88
R4531:Kmo UTSW 1 175659707 splice site probably null
R4586:Kmo UTSW 1 175650572 missense probably damaging 1.00
R4586:Kmo UTSW 1 175650573 missense possibly damaging 0.90
R4603:Kmo UTSW 1 175651642 missense probably benign 0.13
R4647:Kmo UTSW 1 175659774 nonsense probably null
R4728:Kmo UTSW 1 175656763 missense possibly damaging 0.51
R5569:Kmo UTSW 1 175655122 missense probably benign 0.04
R5571:Kmo UTSW 1 175647194 missense possibly damaging 0.46
R6109:Kmo UTSW 1 175637908 missense possibly damaging 0.67
R6244:Kmo UTSW 1 175659695 missense possibly damaging 0.91
R6943:Kmo UTSW 1 175658375 missense probably benign 0.00
R7319:Kmo UTSW 1 175653655 missense probably damaging 0.97
R7450:Kmo UTSW 1 175639100 missense probably benign 0.01
R7545:Kmo UTSW 1 175653628 missense probably damaging 1.00
R7829:Kmo UTSW 1 175650659 splice site probably null
R7916:Kmo UTSW 1 175659670 missense probably damaging 1.00
R8169:Kmo UTSW 1 175649163 missense probably benign 0.10
R8515:Kmo UTSW 1 175647152 missense probably damaging 1.00
X0027:Kmo UTSW 1 175647193 missense probably benign 0.00
Z1177:Kmo UTSW 1 175649186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACACAGCGGCTCTTTC -3'
(R):5'- AGAGAGCCCACTTAGACTTTG -3'

Sequencing Primer
(F):5'- AGCGGCTCTTTCCTCCAGG -3'
(R):5'- GGAAGAAGTCCAGCACAT -3'
Posted On2019-05-15