Incidental Mutation 'R7148:Pjvk'
ID 553924
Institutional Source Beutler Lab
Gene Symbol Pjvk
Ensembl Gene ENSMUSG00000075267
Gene Name pejvakin
Synonyms pejvakin, Dfnb59, LOC381375
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R7148 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 76648476-76658556 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76658487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 334 (K334R)
Ref Sequence ENSEMBL: ENSMUSP00000097566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002809] [ENSMUST00000099986] [ENSMUST00000144817]
AlphaFold Q0ZLH2
Predicted Effect probably benign
Transcript: ENSMUST00000002809
SMART Domains Protein: ENSMUSP00000002809
Gene: ENSMUSG00000002732

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 42 138 7e-31 PFAM
EFh 145 173 1.83e1 SMART
EFh 189 217 5.38e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099986
AA Change: K334R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097566
Gene: ENSMUSG00000075267
AA Change: K334R

DomainStartEndE-ValueType
Pfam:Gasdermin 1 278 7.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144817
SMART Domains Protein: ENSMUSP00000119264
Gene: ENSMUSG00000075267

DomainStartEndE-ValueType
Pfam:Gasdermin 1 184 2.2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gasdermin family, a family which is found only in vertebrates. The encoded protein is required for the proper function of auditory pathway neurons. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal recessive type 59 (DFNB59). [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a point mutation display increased auditory thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Pjvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Pjvk APN 2 76657539 unclassified probably benign
IGL01805:Pjvk APN 2 76657514 missense probably benign 0.11
IGL01821:Pjvk APN 2 76655915 missense probably damaging 0.96
IGL02850:Pjvk APN 2 76658451 missense possibly damaging 0.85
R1757:Pjvk UTSW 2 76655888 missense probably benign
R1851:Pjvk UTSW 2 76657431 critical splice acceptor site probably null
R2152:Pjvk UTSW 2 76658369 missense probably benign 0.10
R2265:Pjvk UTSW 2 76657453 missense possibly damaging 0.84
R4439:Pjvk UTSW 2 76651406 missense probably damaging 1.00
R5207:Pjvk UTSW 2 76650390 critical splice acceptor site probably null
R5381:Pjvk UTSW 2 76651560 splice site probably null
R5819:Pjvk UTSW 2 76658369 missense probably benign
R6165:Pjvk UTSW 2 76650218 splice site probably null
R7559:Pjvk UTSW 2 76655810 missense probably benign 0.07
R7573:Pjvk UTSW 2 76657465 missense probably benign 0.03
R7772:Pjvk UTSW 2 76657533 critical splice donor site probably null
R8475:Pjvk UTSW 2 76650557 missense probably benign
X0026:Pjvk UTSW 2 76650534 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCTTTACCTGGACGACCTC -3'
(R):5'- GAACATAGTAGACATGCGCCATC -3'

Sequencing Primer
(F):5'- TGGACGACCTCTTTTCTGAC -3'
(R):5'- GTAGCACATAAAACGCGC -3'
Posted On 2019-05-15