Incidental Mutation 'R7148:Tekt2'
ID553931
Institutional Source Beutler Lab
Gene Symbol Tekt2
Ensembl Gene ENSMUSG00000028845
Gene Nametektin 2
Synonymstektin-t
MMRRC Submission
Accession Numbers

Genbank: NM_011902.2; Ensembl: ENSMUST00000102616

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126322121-126325688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126322381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 373 (I373T)
Ref Sequence ENSEMBL: ENSMUSP00000030658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
AA Change: I373T

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845
AA Change: I373T

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
AA Change: I373T

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845
AA Change: I373T

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is expressed in the testis and its protein is localized to the flagella of the sperms, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit male infertility and impaired motility of both sperm flagella and tracheal cilia due to altered dynein inner arm morphology and function. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Tekt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tekt2 APN 4 126323189 missense possibly damaging 0.47
IGL01900:Tekt2 APN 4 126324628 missense probably benign 0.00
IGL02452:Tekt2 APN 4 126324852 missense possibly damaging 0.83
IGL02563:Tekt2 APN 4 126324625 missense possibly damaging 0.82
IGL03087:Tekt2 APN 4 126324867 missense possibly damaging 0.63
1mM(1):Tekt2 UTSW 4 126324610 missense probably damaging 0.98
R0747:Tekt2 UTSW 4 126323760 nonsense probably null
R1113:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1308:Tekt2 UTSW 4 126324918 missense probably damaging 0.99
R1524:Tekt2 UTSW 4 126323649 missense probably benign
R1563:Tekt2 UTSW 4 126323407 missense probably benign 0.16
R1819:Tekt2 UTSW 4 126323736 missense probably damaging 1.00
R1930:Tekt2 UTSW 4 126322817 splice site probably null
R1931:Tekt2 UTSW 4 126322817 splice site probably null
R2295:Tekt2 UTSW 4 126323693 unclassified probably null
R4888:Tekt2 UTSW 4 126324667 missense probably benign 0.02
R4902:Tekt2 UTSW 4 126323470 missense possibly damaging 0.95
R5202:Tekt2 UTSW 4 126324670 missense probably benign 0.41
R5219:Tekt2 UTSW 4 126322264 missense possibly damaging 0.51
R5839:Tekt2 UTSW 4 126322836 missense probably damaging 1.00
R6213:Tekt2 UTSW 4 126323196 missense probably damaging 0.99
R6498:Tekt2 UTSW 4 126324305 missense probably benign 0.01
R6963:Tekt2 UTSW 4 126324317 missense probably damaging 0.98
R6988:Tekt2 UTSW 4 126323443 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTCCAGCTGGCAGATTTTG -3'
(R):5'- GTTAGAGGCAACCATCAATACCATG -3'

Sequencing Primer
(F):5'- CAGCTGGCAGATTTTGAGTGGAC -3'
(R):5'- CTGGCCCAAACACAGTAGGTTTAG -3'
Posted On2019-05-15