Incidental Mutation 'R7148:Nsd2'
ID553932
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Namenuclear receptor binding SET domain protein 2
Synonyms5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33820725-33897975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33885511 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1040 (F1040L)
Ref Sequence ENSEMBL: ENSMUSP00000067205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000137191] [ENSMUST00000139845] [ENSMUST00000202525]
Predicted Effect probably benign
Transcript: ENSMUST00000058096
AA Change: F1039L

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: F1039L

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066854
AA Change: F1040L

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: F1040L

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075812
AA Change: F1040L

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: F1040L

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137191
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141416
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202525
SMART Domains Protein: ENSMUSP00000144255
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
PHD 11 53 8.5e-9 SMART
RING 12 52 7.3e-2 SMART
PHD 58 105 4.4e-3 SMART
RING 59 104 2.6e-4 SMART
PHD 175 215 1.5e-12 SMART
low complexity region 248 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 33855733 missense probably damaging 1.00
IGL00420:Nsd2 APN 5 33883003 missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 33843578 missense probably damaging 1.00
IGL01403:Nsd2 APN 5 33885378 splice site probably benign
IGL01446:Nsd2 APN 5 33861186 splice site probably benign
IGL01571:Nsd2 APN 5 33864687 missense probably benign 0.32
IGL01862:Nsd2 APN 5 33843736 missense probably null 1.00
IGL02040:Nsd2 APN 5 33867571 splice site probably benign
IGL02528:Nsd2 APN 5 33879051 unclassified probably benign
IGL02553:Nsd2 APN 5 33846198 missense probably damaging 1.00
IGL02799:Nsd2 APN 5 33864788 splice site probably benign
IGL02932:Nsd2 APN 5 33880128 missense probably damaging 1.00
Tennis UTSW 5 33843513 missense probably damaging 1.00
R0136:Nsd2 UTSW 5 33855536 missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 33891551 missense probably damaging 0.98
R0521:Nsd2 UTSW 5 33843338 missense probably damaging 1.00
R0548:Nsd2 UTSW 5 33893538 missense probably damaging 1.00
R0726:Nsd2 UTSW 5 33861028 unclassified probably benign
R1018:Nsd2 UTSW 5 33843241 missense probably damaging 1.00
R1638:Nsd2 UTSW 5 33882120 missense possibly damaging 0.87
R1649:Nsd2 UTSW 5 33854640 missense probably damaging 0.98
R1675:Nsd2 UTSW 5 33861149 missense probably benign 0.04
R1900:Nsd2 UTSW 5 33846169 missense probably benign
R2001:Nsd2 UTSW 5 33843402 missense probably damaging 1.00
R2167:Nsd2 UTSW 5 33882919 missense probably damaging 1.00
R2261:Nsd2 UTSW 5 33885527 missense probably damaging 1.00
R2966:Nsd2 UTSW 5 33846122 missense probably benign 0.01
R3931:Nsd2 UTSW 5 33846117 missense probably benign 0.01
R4429:Nsd2 UTSW 5 33843202 missense probably damaging 1.00
R4596:Nsd2 UTSW 5 33882918 missense probably damaging 1.00
R4958:Nsd2 UTSW 5 33892022 missense probably damaging 1.00
R5346:Nsd2 UTSW 5 33879136 missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 33855603 missense probably damaging 1.00
R6054:Nsd2 UTSW 5 33882161 missense probably damaging 1.00
R6124:Nsd2 UTSW 5 33843266 missense probably benign 0.08
R6302:Nsd2 UTSW 5 33867577 missense possibly damaging 0.93
R6390:Nsd2 UTSW 5 33881181 missense probably damaging 1.00
R6496:Nsd2 UTSW 5 33843513 missense probably damaging 1.00
R6828:Nsd2 UTSW 5 33893568 missense probably damaging 0.98
R6925:Nsd2 UTSW 5 33879110 missense probably damaging 1.00
R7311:Nsd2 UTSW 5 33892036 missense probably damaging 1.00
R7337:Nsd2 UTSW 5 33885472 missense probably damaging 1.00
R7466:Nsd2 UTSW 5 33882147 nonsense probably null
R7567:Nsd2 UTSW 5 33846226 missense probably damaging 0.99
X0020:Nsd2 UTSW 5 33854757 missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 33855738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTATGAGTGTGCAGCGTCC -3'
(R):5'- CACACAATAAGCAGTGGGCC -3'

Sequencing Primer
(F):5'- CCAGGGCTCTCTGTTTACAAAGTAG -3'
(R):5'- GATGGACCTGAGTTCAATCCCTG -3'
Posted On2019-05-15