Incidental Mutation 'R7148:Hyal5'
ID553937
Institutional Source Beutler Lab
Gene Symbol Hyal5
Ensembl Gene ENSMUSG00000029678
Gene Namehyaluronoglucosaminidase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location24857997-24891958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24876902 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 258 (L258Q)
Ref Sequence ENSEMBL: ENSMUSP00000144011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031689] [ENSMUST00000200968]
Predicted Effect probably damaging
Transcript: ENSMUST00000031689
AA Change: L258Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031689
Gene: ENSMUSG00000029678
AA Change: L258Q

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200968
AA Change: L258Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144011
Gene: ENSMUSG00000029678
AA Change: L258Q

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Reproduction is normal in mice with null mutations at this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Hyal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Hyal5 APN 6 24876481 missense possibly damaging 0.92
IGL01407:Hyal5 APN 6 24876407 missense probably benign 0.08
IGL01799:Hyal5 APN 6 24891337 missense probably benign 0.09
IGL02070:Hyal5 APN 6 24876962 missense probably damaging 1.00
IGL02087:Hyal5 APN 6 24876725 missense probably damaging 1.00
IGL02188:Hyal5 APN 6 24877036 missense probably damaging 1.00
IGL02321:Hyal5 APN 6 24891615 missense probably benign 0.01
IGL02975:Hyal5 APN 6 24891452 missense probably benign 0.41
IGL03299:Hyal5 APN 6 24877882 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0499:Hyal5 UTSW 6 24877921 missense probably damaging 1.00
R1491:Hyal5 UTSW 6 24877903 missense probably benign 0.00
R1575:Hyal5 UTSW 6 24876793 missense probably damaging 1.00
R1967:Hyal5 UTSW 6 24876194 missense possibly damaging 0.68
R2182:Hyal5 UTSW 6 24877880 missense probably damaging 1.00
R3801:Hyal5 UTSW 6 24876524 missense probably benign 0.44
R3877:Hyal5 UTSW 6 24876631 missense probably damaging 1.00
R4642:Hyal5 UTSW 6 24876622 missense probably benign 0.01
R4826:Hyal5 UTSW 6 24891576 missense possibly damaging 0.82
R5058:Hyal5 UTSW 6 24891485 missense probably damaging 1.00
R5161:Hyal5 UTSW 6 24891603 missense probably benign 0.00
R5249:Hyal5 UTSW 6 24876649 nonsense probably null
R5459:Hyal5 UTSW 6 24891251 missense probably damaging 0.98
R5685:Hyal5 UTSW 6 24876692 missense probably benign 0.39
R5741:Hyal5 UTSW 6 24876495 missense probably damaging 1.00
R5849:Hyal5 UTSW 6 24891556 missense probably benign 0.00
R6156:Hyal5 UTSW 6 24891438 missense possibly damaging 0.92
R6351:Hyal5 UTSW 6 24891709 unclassified probably null
R6573:Hyal5 UTSW 6 24891552 missense probably damaging 0.96
R6949:Hyal5 UTSW 6 24876304 missense probably benign 0.00
R6966:Hyal5 UTSW 6 24891292 missense probably damaging 1.00
R7422:Hyal5 UTSW 6 24875984 start gained probably benign
R7836:Hyal5 UTSW 6 24891348 missense probably damaging 1.00
R7919:Hyal5 UTSW 6 24891348 missense probably damaging 1.00
R8062:Hyal5 UTSW 6 24876197 missense possibly damaging 0.73
X0061:Hyal5 UTSW 6 24876973 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTGTCAAGTGGGCCAAAG -3'
(R):5'- AGCTACCATGCCTTGATTTACTTAC -3'

Sequencing Primer
(F):5'- TTGAAGAGGCAGCAAGACATTTTATG -3'
(R):5'- TAGGAAGTGGATTTCGAGG -3'
Posted On2019-05-15