Incidental Mutation 'R7148:AF366264'
ID553946
Institutional Source Beutler Lab
Gene Symbol AF366264
Ensembl Gene ENSMUSG00000057116
Gene NamecDNA sequence AF366264
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13835233-13838389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13837996 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 32 (I32L)
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
Predicted Effect probably benign
Transcript: ENSMUST00000071308
AA Change: I32L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116
AA Change: I32L

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in AF366264
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:AF366264 APN 8 13837704 missense probably benign 0.03
IGL02647:AF366264 APN 8 13836979 missense probably damaging 0.96
IGL03118:AF366264 APN 8 13838096 utr 5 prime probably benign
FR4342:AF366264 UTSW 8 13837613 missense probably benign 0.00
R0636:AF366264 UTSW 8 13837870 missense probably benign 0.00
R1796:AF366264 UTSW 8 13836816 nonsense probably null
R1913:AF366264 UTSW 8 13837143 missense probably benign 0.16
R2353:AF366264 UTSW 8 13836951 missense probably damaging 1.00
R2944:AF366264 UTSW 8 13837212 missense probably damaging 1.00
R3714:AF366264 UTSW 8 13836736 missense probably benign 0.04
R4222:AF366264 UTSW 8 13838061 missense probably benign
R4628:AF366264 UTSW 8 13836625 missense probably damaging 1.00
R4801:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4802:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4836:AF366264 UTSW 8 13838007 missense probably benign
R5143:AF366264 UTSW 8 13836844 missense possibly damaging 0.87
R5637:AF366264 UTSW 8 13837713 missense possibly damaging 0.46
R5930:AF366264 UTSW 8 13837263 missense probably benign 0.06
R6540:AF366264 UTSW 8 13837573 missense probably benign 0.07
R6556:AF366264 UTSW 8 13837690 nonsense probably null
R6724:AF366264 UTSW 8 13837083 missense probably damaging 1.00
R7131:AF366264 UTSW 8 13836982 missense probably damaging 0.98
R7660:AF366264 UTSW 8 13837995 missense probably benign 0.06
X0020:AF366264 UTSW 8 13836847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCCTTCGGTCAACTCTAGG -3'
(R):5'- CAGAGCCAGGTATAAGGTTGC -3'

Sequencing Primer
(F):5'- CCTTCGGTCAACTCTAGGGGTTTTAG -3'
(R):5'- AGCCAGGTATAAGGTTGCTTTCAC -3'
Posted On2019-05-15