Incidental Mutation 'R7148:Usp10'
ID 553954
Institutional Source Beutler Lab
Gene Symbol Usp10
Ensembl Gene ENSMUSG00000031826
Gene Name ubiquitin specific peptidase 10
Synonyms Uchrp, 2610014N07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7148 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 119910360-119957560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119936550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 37 (T37I)
Ref Sequence ENSEMBL: ENSMUSP00000123590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108982] [ENSMUST00000108988] [ENSMUST00000127664] [ENSMUST00000144458]
AlphaFold P52479
Predicted Effect probably benign
Transcript: ENSMUST00000108982
SMART Domains Protein: ENSMUSP00000104610
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
Pfam:UCH 9 113 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108988
AA Change: T37I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104616
Gene: ENSMUSG00000031826
AA Change: T37I

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
low complexity region 147 155 N/A INTRINSIC
Pfam:UCH 408 786 9.3e-48 PFAM
Pfam:UCH_1 409 764 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144458
AA Change: T37I

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123590
Gene: ENSMUSG00000031826
AA Change: T37I

DomainStartEndE-ValueType
Pfam:PAM2 78 95 1.1e-7 PFAM
low complexity region 118 132 N/A INTRINSIC
low complexity region 148 156 N/A INTRINSIC
Pfam:UCH 409 787 1.2e-44 PFAM
Pfam:UCH_1 410 765 4.2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in arsenite-induced stress granule formation, reactive oxygen species (ROS) production, and ROS-dependent apoptosis in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Usp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Usp10 APN 8 119948741 missense possibly damaging 0.95
IGL02444:Usp10 APN 8 119948693 missense possibly damaging 0.70
IGL02487:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02526:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02951:Usp10 APN 8 119947086 missense probably benign 0.01
IGL03003:Usp10 APN 8 119954810 missense possibly damaging 0.90
IGL03049:Usp10 APN 8 119956627 missense probably benign 0.01
PIT4585001:Usp10 UTSW 8 119954892 missense probably benign 0.02
R0090:Usp10 UTSW 8 119953196 nonsense probably null
R0329:Usp10 UTSW 8 119936557 nonsense probably null
R0550:Usp10 UTSW 8 119947801 missense probably damaging 0.98
R2349:Usp10 UTSW 8 119956709 makesense probably null
R4345:Usp10 UTSW 8 119954814 missense probably damaging 1.00
R4782:Usp10 UTSW 8 119941191 missense probably benign 0.03
R5182:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5184:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5461:Usp10 UTSW 8 119956667 missense probably benign 0.44
R5749:Usp10 UTSW 8 119941133 missense probably damaging 0.99
R5873:Usp10 UTSW 8 119947092 missense possibly damaging 0.60
R5935:Usp10 UTSW 8 119947089 missense possibly damaging 0.74
R6242:Usp10 UTSW 8 119941838 missense probably benign 0.01
R6362:Usp10 UTSW 8 119941316 missense probably benign 0.00
R6608:Usp10 UTSW 8 119948422 missense probably benign 0.06
R6774:Usp10 UTSW 8 119951972 missense probably benign
R7164:Usp10 UTSW 8 119942108 missense probably damaging 1.00
R7238:Usp10 UTSW 8 119941544 missense probably benign
R7310:Usp10 UTSW 8 119941605 missense possibly damaging 0.89
R7792:Usp10 UTSW 8 119952001 missense possibly damaging 0.54
R8552:Usp10 UTSW 8 119956628 missense possibly damaging 0.81
R9020:Usp10 UTSW 8 119941165 missense probably benign 0.30
R9380:Usp10 UTSW 8 119956204 missense probably damaging 1.00
R9484:Usp10 UTSW 8 119948765 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTCAGATTGGGGCGAATCTG -3'
(R):5'- TGAGCCTGCTAACCTACAAAG -3'

Sequencing Primer
(F):5'- CGAATCTGTGTCTTCCTGGGAAC -3'
(R):5'- TGCATAAGCCCGATGACCTCTG -3'
Posted On 2019-05-15