Mutagenetix > Incidental Mutations

Incidental Mutation 'R7148:Pfkfb4'

553957

Institutional Source

Beutler Lab

Gene Symbol

Pfkfb4

Ensembl Gene

ENSMUSG00000025648

Gene Name

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7148 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108991778-109032228 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109027608 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 394 (V394A)

Ref Sequence

ENSEMBL: ENSMUSP00000142378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051873
AA Change: V378A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: V378A

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	3.2e-105	PFAM
Pfam:AAA_33	41	199	2.3e-8	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196249

Predicted Effect

probably damaging
Transcript: ENSMUST00000198140
AA Change: V394A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: V394A

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.9e-105	PFAM
Pfam:AAA_33	41	198	8.5e-10	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199591
AA Change: S387P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: S387P

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.4e-105	PFAM
Pfam:AAA_33	41	198	6.6e-10	PFAM
PGAM	251	396	4.98e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200015

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024G13Rik	T	A	14: 32,388,312	Y14F	probably damaging	Het
2410131K14Rik	A	G	5: 118,255,694	N46D	probably benign	Het
4930563D23Rik	T	C	16: 92,320,987	K138E	probably benign	Het
Acly	A	G	11: 100,483,782	V805A	possibly damaging	Het
AF366264	T	A	8: 13,837,996	I32L	probably benign	Het
Apcdd1	T	C	18: 62,951,845	V371A	probably damaging	Het
Cacna1g	A	T	11: 94,465,930	F127I	probably benign	Het
Ccdc129	T	C	6: 55,897,686	I207T	probably damaging	Het
Ccdc138	T	C	10: 58,538,280	L374P	probably damaging	Het
Ces2b	A	G	8: 104,838,296	Y504C	probably damaging	Het
Ces5a	C	T	8: 93,502,322	G427S	probably damaging	Het
Chd1l	C	T	3: 97,591,316	V256M	probably damaging	Het
Col24a1	C	T	3: 145,315,299	T477M	probably damaging	Het
Dmbt1	T	A	7: 131,066,734	C573*	probably null	Het
Emcn	A	T	3: 137,417,094	Y188F	possibly damaging	Het
Eva1a	T	G	6: 82,071,144	M1R	probably null	Het
Fam83h	C	A	15: 76,005,167	D194Y	probably damaging	Het
Flywch1	T	C	17: 23,755,675	K664E	probably benign	Het
Fzd9	A	G	5: 135,249,690	V447A	probably benign	Het
Gm21964	G	T	8: 110,109,416	R119I	probably benign	Het
Heatr5b	T	C	17: 78,831,434	D93G	probably damaging	Het
Hmcn1	T	C	1: 150,686,854	I2318V	probably benign	Het
Hyal5	T	A	6: 24,876,902	L258Q	probably damaging	Het
Kmo	T	A	1: 175,651,602	C235S	probably damaging	Het
Lamc2	G	A	1: 153,185,984	P2S	probably benign	Het
Lman2	G	A	13: 55,352,949	P146S	probably benign	Het
Mars2	T	C	1: 55,237,514	I92T	probably damaging	Het
Msh3	A	G	13: 92,354,822	F27L	probably benign	Het
Myom2	T	C	8: 15,084,577	V460A	possibly damaging	Het
Nicn1	T	A	9: 108,295,107	*214R	probably null	Het
Nsd2	T	C	5: 33,885,511	F1040L	possibly damaging	Het
Olfr374	T	A	8: 72,110,157	I197N	possibly damaging	Het
Osm	T	A	11: 4,239,936	I240N	probably benign	Het
Pard3b	T	A	1: 62,440,032	D884E	probably benign	Het
Pex5	T	G	6: 124,405,272	D150A	probably benign	Het
Pjvk	A	G	2: 76,658,487	K334R	possibly damaging	Het
Pkd1l2	T	C	8: 117,080,786	D171G	probably benign	Het
Prpf4b	T	G	13: 34,894,472	N688K	probably benign	Het
R3hcc1	T	C	14: 69,705,552	E192G	possibly damaging	Het
Rad54l2	C	A	9: 106,719,119	G207*	probably null	Het
Rhobtb3	G	T	13: 75,910,887	T264K	probably benign	Het
Rpl27	A	G	11: 101,442,406		probably benign	Het
Rxfp3	C	T	15: 11,036,777	V170I	possibly damaging	Het
Samd4	T	A	14: 47,016,683	S201R	probably benign	Het
Sell	A	G	1: 164,065,607	I131V	possibly damaging	Het
Sirpb1c	A	T	3: 15,833,059	Y205*	probably null	Het
Smc3	A	T	19: 53,641,895	E1111V	possibly damaging	Het
Sowaha	C	A	11: 53,479,355	V185L	probably benign	Het
Spata4	A	C	8: 54,602,550	I159L	probably benign	Het
Tekt2	A	G	4: 126,322,381	I373T	probably benign	Het
Tomm20l	T	C	12: 71,117,539	V65A	probably benign	Het
Trabd2b	A	G	4: 114,409,350	D187G	probably damaging	Het
Trrap	A	G	5: 144,821,803	I2147V	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,008	C440*	probably null	Het
Ube3b	A	C	5: 114,406,252	N570T	probably damaging	Het
Uevld	A	G	7: 46,950,976	I70T	probably damaging	Het
Usp10	C	T	8: 119,936,550	T37I	possibly damaging	Het
Vmn2r23	T	A	6: 123,713,022	F286I	probably benign	Het
Vmn2r62	A	G	7: 42,765,216	V601A	probably benign	Het
Wdr81	G	C	11: 75,446,002	N401K		Het
Ythdc2	G	T	18: 44,833,122	V142F	probably benign	Het
Zfp346	T	C	13: 55,105,450	F36S	possibly damaging	Het
Zfp748	C	T	13: 67,542,239	V301M	possibly damaging	Het
Zim1	T	C	7: 6,678,221	K148E	possibly damaging	Het

Other mutations in Pfkfb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01653:Pfkfb4	APN	9	108999134	missense	probably damaging	1.00
IGL01978:Pfkfb4	APN	9	109028942	missense	probably damaging	1.00
IGL02119:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02121:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02122:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02123:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02125:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02126:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02506:Pfkfb4	APN	9	109030336	missense	probably benign	0.00
IGL02881:Pfkfb4	APN	9	109007296	missense	probably null	1.00
PIT4466001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
PIT4472001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
R0087:Pfkfb4	UTSW	9	109007701	missense	probably damaging	1.00
R0101:Pfkfb4	UTSW	9	109010643	missense	probably benign	0.03
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0379:Pfkfb4	UTSW	9	109027742	splice site	probably benign
R0511:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1490:Pfkfb4	UTSW	9	109027620	missense	probably damaging	1.00
R1521:Pfkfb4	UTSW	9	109007305	missense	probably damaging	1.00
R1932:Pfkfb4	UTSW	9	108999169	missense	probably damaging	1.00
R2214:Pfkfb4	UTSW	9	109005609	missense	probably benign	0.17
R3112:Pfkfb4	UTSW	9	109025042	splice site	probably benign
R5470:Pfkfb4	UTSW	9	109027593	missense	probably damaging	1.00
R5646:Pfkfb4	UTSW	9	109008421	missense	probably damaging	1.00
R5930:Pfkfb4	UTSW	9	109030394	unclassified	probably benign
R6139:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R6632:Pfkfb4	UTSW	9	109009562	splice site	probably null
R6873:Pfkfb4	UTSW	9	109010335	splice site	probably null
R6958:Pfkfb4	UTSW	9	109010547	missense	probably damaging	1.00
R7098:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.05
R7131:Pfkfb4	UTSW	9	109007302	missense	probably benign	0.21
R7284:Pfkfb4	UTSW	9	109011240	missense	possibly damaging	0.88
R7903:Pfkfb4	UTSW	9	108998951	missense	probably damaging	1.00
R7973:Pfkfb4	UTSW	9	109025111	missense	probably damaging	1.00
R8506:Pfkfb4	UTSW	9	109005599	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GTGTCAGGTTGTCATAAGATCAGAC -3'
(R):5'- AGGAAGCTCCCTTACCGTAAG -3'

Sequencing Primer
(F):5'- CAGGTTGTCATAAGATCAGACAGAAG -3'
(R):5'- AGCTTCAGGACTGTGTGCAAG -3'

Posted On

2019-05-15