Incidental Mutation 'R7148:Pfkfb4'
ID553957
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108991778-109032228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109027608 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 394 (V394A)
Ref Sequence ENSEMBL: ENSMUSP00000142378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
Predicted Effect probably damaging
Transcript: ENSMUST00000051873
AA Change: V378A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: V378A

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably damaging
Transcript: ENSMUST00000198140
AA Change: V394A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: V394A

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199591
AA Change: S387P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: S387P

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200015
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 109027742 splice site probably benign
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 109007305 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 109005609 missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 109009562 intron probably null
R6873:Pfkfb4 UTSW 9 109010335 intron probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 109007302 missense probably benign 0.21
R7284:Pfkfb4 UTSW 9 109011240 missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
R7986:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAGGTTGTCATAAGATCAGAC -3'
(R):5'- AGGAAGCTCCCTTACCGTAAG -3'

Sequencing Primer
(F):5'- CAGGTTGTCATAAGATCAGACAGAAG -3'
(R):5'- AGCTTCAGGACTGTGTGCAAG -3'
Posted On2019-05-15