Incidental Mutation 'R7148:Zfp346'
ID553967
Institutional Source Beutler Lab
Gene Symbol Zfp346
Ensembl Gene ENSMUSG00000021481
Gene Namezinc finger protein 346
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55105311-55134825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55105450 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 36 (F36S)
Ref Sequence ENSEMBL: ENSMUSP00000021937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021937] [ENSMUST00000159147] [ENSMUST00000159278] [ENSMUST00000160660] [ENSMUST00000161315] [ENSMUST00000161551] [ENSMUST00000162428] [ENSMUST00000162476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021937
AA Change: F36S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021937
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 182 216 1.87e-8 SMART
ZnF_C2H2 185 209 1.51e1 SMART
ZnF_U1 236 270 1.99e-3 SMART
ZnF_C2H2 239 263 3.47e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159147
AA Change: F36S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124107
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:zf-met 73 96 3.3e-5 PFAM
ZnF_U1 99 133 5.22e-7 SMART
ZnF_C2H2 102 126 4.98e-1 SMART
ZnF_U1 150 184 1.87e-8 SMART
ZnF_C2H2 153 177 1.51e1 SMART
ZnF_U1 204 238 1.99e-3 SMART
ZnF_C2H2 207 231 3.47e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159278
AA Change: F36S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125078
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 198 232 1.87e-8 SMART
ZnF_C2H2 201 225 1.51e1 SMART
ZnF_U1 251 285 1.99e-3 SMART
ZnF_C2H2 254 278 3.47e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160660
AA Change: F36S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124034
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000125204
Gene: ENSMUSG00000021481
AA Change: F17S

DomainStartEndE-ValueType
ZnF_U1 52 86 1.26e-5 SMART
ZnF_C2H2 55 79 2.61e1 SMART
ZnF_U1 113 147 5.22e-7 SMART
ZnF_C2H2 116 140 4.98e-1 SMART
ZnF_U1 180 214 1.87e-8 SMART
ZnF_C2H2 183 207 1.51e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161315
AA Change: F36S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124397
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161551
AA Change: F36S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124180
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
PDB:1ZU1|A 53 93 4e-12 PDB
Blast:ZnF_U1 70 94 3e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162428
AA Change: F36S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125389
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162476
AA Change: F36S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125743
Gene: ENSMUSG00000021481
AA Change: F36S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar, zinc finger protein that preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids, rather than DNA alone. Mutational studies indicate that the zinc finger domains are not only essential for dsRNA binding, but are also required for its nucleolar localization. The encoded protein may be involved in cell growth and survival. It plays a role in protecting neurons by inhibiting cell cycle re-entry via stimulation of p21 gene expression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Zfp346
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Zfp346 UTSW 13 55113097 nonsense probably null
R2025:Zfp346 UTSW 13 55132308 missense probably damaging 1.00
R2879:Zfp346 UTSW 13 55105350 missense possibly damaging 0.66
R4564:Zfp346 UTSW 13 55113707 missense probably damaging 1.00
R4821:Zfp346 UTSW 13 55113813 intron probably benign
R5647:Zfp346 UTSW 13 55122357 missense probably damaging 1.00
R5665:Zfp346 UTSW 13 55113102 missense probably benign 0.39
R6145:Zfp346 UTSW 13 55115574 missense probably damaging 0.98
R6450:Zfp346 UTSW 13 55113704 missense probably damaging 1.00
R7034:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7036:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7298:Zfp346 UTSW 13 55130603 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAACTTCGCGAGAGTTGC -3'
(R):5'- CGAGTTACTAGGTCCAGCAC -3'

Sequencing Primer
(F):5'- TTGCTGGCCGGGTCAAATC -3'
(R):5'- AGCACCCTTCGCGAGAG -3'
Posted On2019-05-15