Incidental Mutation 'R7148:Lman2'
ID553968
Institutional Source Beutler Lab
Gene Symbol Lman2
Ensembl Gene ENSMUSG00000021484
Gene Namelectin, mannose-binding 2
Synonyms1300009F09Rik, 1110003H06Rik, VIP36, GP36B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55343833-55362783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55352949 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 146 (P146S)
Ref Sequence ENSEMBL: ENSMUSP00000021940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021940]
Predicted Effect probably benign
Transcript: ENSMUST00000021940
AA Change: P146S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021940
Gene: ENSMUSG00000021484
AA Change: P146S

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
Pfam:Lectin_leg-like 54 280 6.6e-104 PFAM
transmembrane domain 325 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Lman2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lman2 APN 13 55351242 missense possibly damaging 0.91
IGL02381:Lman2 APN 13 55351469 missense possibly damaging 0.77
R0331:Lman2 UTSW 13 55353016 missense probably damaging 1.00
R1457:Lman2 UTSW 13 55351251 missense probably benign 0.01
R1482:Lman2 UTSW 13 55351405 missense possibly damaging 0.92
R2209:Lman2 UTSW 13 55351502 missense probably damaging 0.99
R2347:Lman2 UTSW 13 55352999 missense possibly damaging 0.91
R6132:Lman2 UTSW 13 55362225 missense probably benign
R6297:Lman2 UTSW 13 55348431 missense probably damaging 0.99
R6461:Lman2 UTSW 13 55346915 missense probably damaging 1.00
R7422:Lman2 UTSW 13 55351525 missense probably damaging 1.00
R7498:Lman2 UTSW 13 55346977 missense probably damaging 1.00
R7720:Lman2 UTSW 13 55353077 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTATAGGAAAATGGCCAGGTGTG -3'
(R):5'- TGCTCCAGCTTGCTTGAAAG -3'

Sequencing Primer
(F):5'- CAGCCTGGGATATATAGTCCAAGTC -3'
(R):5'- AAAGCCTTGGTATTCTGAGGGCC -3'
Posted On2019-05-15