Incidental Mutation 'R7148:Msh3'
ID553971
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92354822 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 27 (F27L)
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022218] [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022218
SMART Domains Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

DomainStartEndE-ValueType
Pfam:DHFR_1 4 185 3.9e-37 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
AA Change: F27L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187424
AA Change: F27L
SMART Domains Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187874
AA Change: F27L
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190393
AA Change: F27L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191509
AA Change: F27L
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
AA Change: F27L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850
AA Change: F27L

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCTCTCCATAAGGCCTCCG -3'
(R):5'- CGCATTCTATTTGTGTAGCTAAGG -3'

Sequencing Primer
(F):5'- ATAAGGCCTCCGCTTCCG -3'
(R):5'- TAGCAGGCCGGCTCTTCTGCACACT -3'
Posted On2019-05-15