Incidental Mutation 'R7148:Fam83h'
ID553976
Institutional Source Beutler Lab
Gene Symbol Fam83h
Ensembl Gene ENSMUSG00000046761
Gene Namefamily with sequence similarity 83, member H
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76001093-76014336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76005167 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 194 (D194Y)
Ref Sequence ENSEMBL: ENSMUSP00000059839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060807] [ENSMUST00000170153] [ENSMUST00000187868]
Predicted Effect probably damaging
Transcript: ENSMUST00000060807
AA Change: D194Y

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059839
Gene: ENSMUSG00000046761
AA Change: D194Y

DomainStartEndE-ValueType
Pfam:DUF1669 12 283 3.4e-105 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000170153
AA Change: D194Y

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126453
Gene: ENSMUSG00000046761
AA Change: D194Y

DomainStartEndE-ValueType
Pfam:DUF1669 4 284 2.1e-110 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000187868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in the structural development and calcification of tooth enamel. Defects in this gene are a cause of amelogenesis imperfecta type 3 (AI3). [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Fam83h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Fam83h APN 15 76004036 missense probably damaging 0.98
IGL01463:Fam83h APN 15 76003788 missense possibly damaging 0.57
IGL01789:Fam83h APN 15 76006120 missense probably damaging 1.00
IGL02029:Fam83h APN 15 76006438 missense probably damaging 1.00
IGL02157:Fam83h APN 15 76005055 missense probably damaging 1.00
IGL03225:Fam83h APN 15 76003301 missense probably damaging 1.00
PIT4260001:Fam83h UTSW 15 76001897 missense probably damaging 1.00
R0008:Fam83h UTSW 15 76003962 missense probably damaging 1.00
R0071:Fam83h UTSW 15 76002528 missense probably benign
R0318:Fam83h UTSW 15 76003629 missense probably benign 0.04
R0539:Fam83h UTSW 15 76003227 missense possibly damaging 0.88
R0638:Fam83h UTSW 15 76003927 missense probably benign 0.01
R0790:Fam83h UTSW 15 76003392 missense probably benign 0.43
R0883:Fam83h UTSW 15 76006169 missense probably damaging 1.00
R1970:Fam83h UTSW 15 76006570 unclassified probably benign
R2046:Fam83h UTSW 15 76002938 missense probably benign
R2114:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2115:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2117:Fam83h UTSW 15 76004733 nonsense probably null
R3702:Fam83h UTSW 15 76002650 missense probably benign
R3842:Fam83h UTSW 15 76002650 missense probably benign
R4729:Fam83h UTSW 15 76002336 missense probably benign
R4791:Fam83h UTSW 15 76002368 missense probably damaging 1.00
R5024:Fam83h UTSW 15 76005142 missense probably damaging 1.00
R5471:Fam83h UTSW 15 76002903 missense probably benign 0.00
R6013:Fam83h UTSW 15 76004000 missense probably damaging 0.99
R6488:Fam83h UTSW 15 76002053 missense possibly damaging 0.67
R6558:Fam83h UTSW 15 76004453 missense probably damaging 1.00
R6618:Fam83h UTSW 15 76003511 missense probably damaging 1.00
R7030:Fam83h UTSW 15 76004739 missense probably benign 0.08
R7191:Fam83h UTSW 15 76003037 missense probably damaging 1.00
R7438:Fam83h UTSW 15 76004426 missense possibly damaging 0.93
R7705:Fam83h UTSW 15 76003850 missense probably damaging 0.99
R8194:Fam83h UTSW 15 76002775 small deletion probably benign
R8218:Fam83h UTSW 15 76003037 missense probably damaging 1.00
R8282:Fam83h UTSW 15 76002775 small deletion probably benign
R8293:Fam83h UTSW 15 76002775 small deletion probably benign
R8493:Fam83h UTSW 15 76002653 missense probably benign 0.00
X0010:Fam83h UTSW 15 76004939 critical splice donor site probably null
X0061:Fam83h UTSW 15 76003503 missense probably damaging 1.00
Z1177:Fam83h UTSW 15 76002962 missense probably benign 0.00
Z1177:Fam83h UTSW 15 76006541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCTTGAAAGACTTCCC -3'
(R):5'- AATTCATGACCAGTCTCTCCTG -3'

Sequencing Primer
(F):5'- TTGAAAGACTTCCCAGTGCG -3'
(R):5'- AGGATGACCAGGCCCTTC -3'
Posted On2019-05-15