Incidental Mutation 'R7148:Fam243'
ID 553977
Institutional Source Beutler Lab
Gene Symbol Fam243
Ensembl Gene ENSMUSG00000051728
Gene Name family with sequence similarity 243
Synonyms 4930563D23Rik
MMRRC Submission 045225-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7148 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 92115653-92118329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92117875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 138 (K138E)
Ref Sequence ENSEMBL: ENSMUSP00000049694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062638]
AlphaFold Q8CDS7
Predicted Effect probably benign
Transcript: ENSMUST00000062638
AA Change: K138E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,110,269 (GRCm39) Y14F probably damaging Het
Acly A G 11: 100,374,608 (GRCm39) V805A possibly damaging Het
Apcdd1 T C 18: 63,084,916 (GRCm39) V371A probably damaging Het
Cacna1g A T 11: 94,356,756 (GRCm39) F127I probably benign Het
Ccdc138 T C 10: 58,374,102 (GRCm39) L374P probably damaging Het
Ces2b A G 8: 105,564,928 (GRCm39) Y504C probably damaging Het
Ces5a C T 8: 94,228,950 (GRCm39) G427S probably damaging Het
Chd1l C T 3: 97,498,632 (GRCm39) V256M probably damaging Het
Col24a1 C T 3: 145,021,060 (GRCm39) T477M probably damaging Het
Dmbt1 T A 7: 130,668,464 (GRCm39) C573* probably null Het
Emcn A T 3: 137,122,855 (GRCm39) Y188F possibly damaging Het
Eva1a T G 6: 82,048,125 (GRCm39) M1R probably null Het
Fam83h C A 15: 75,877,016 (GRCm39) D194Y probably damaging Het
Flywch1 T C 17: 23,974,649 (GRCm39) K664E probably benign Het
Fzd9 A G 5: 135,278,544 (GRCm39) V447A probably benign Het
Heatr5b T C 17: 79,138,863 (GRCm39) D93G probably damaging Het
Hmcn1 T C 1: 150,562,605 (GRCm39) I2318V probably benign Het
Hyal5 T A 6: 24,876,901 (GRCm39) L258Q probably damaging Het
Itprid1 T C 6: 55,874,671 (GRCm39) I207T probably damaging Het
Kmo T A 1: 175,479,168 (GRCm39) C235S probably damaging Het
Lamc2 G A 1: 153,061,730 (GRCm39) P2S probably benign Het
Lman2 G A 13: 55,500,762 (GRCm39) P146S probably benign Het
Mars2 T C 1: 55,276,673 (GRCm39) I92T probably damaging Het
Msh3 A G 13: 92,491,330 (GRCm39) F27L probably benign Het
Myom2 T C 8: 15,134,577 (GRCm39) V460A possibly damaging Het
Nicn1 T A 9: 108,172,306 (GRCm39) *214R probably null Het
Nsd2 T C 5: 34,042,855 (GRCm39) F1040L possibly damaging Het
Or1ab2 T A 8: 72,864,001 (GRCm39) I197N possibly damaging Het
Osm T A 11: 4,189,936 (GRCm39) I240N probably benign Het
Pard3b T A 1: 62,479,191 (GRCm39) D884E probably benign Het
Pex5 T G 6: 124,382,231 (GRCm39) D150A probably benign Het
Pfkfb4 T C 9: 108,856,676 (GRCm39) V394A probably damaging Het
Pjvk A G 2: 76,488,831 (GRCm39) K334R possibly damaging Het
Pkd1l2 T C 8: 117,807,525 (GRCm39) D171G probably benign Het
Prpf4b T G 13: 35,078,455 (GRCm39) N688K probably benign Het
R3hcc1 T C 14: 69,943,001 (GRCm39) E192G possibly damaging Het
Rad54l2 C A 9: 106,596,318 (GRCm39) G207* probably null Het
Rhobtb3 G T 13: 76,059,006 (GRCm39) T264K probably benign Het
Rpl27 A G 11: 101,333,232 (GRCm39) probably benign Het
Rxfp3 C T 15: 11,036,863 (GRCm39) V170I possibly damaging Het
Samd4 T A 14: 47,254,140 (GRCm39) S201R probably benign Het
Sell A G 1: 163,893,176 (GRCm39) I131V possibly damaging Het
Semp2l2a T A 8: 13,887,996 (GRCm39) I32L probably benign Het
Sirpb1c A T 3: 15,887,223 (GRCm39) Y205* probably null Het
Smc3 A T 19: 53,630,326 (GRCm39) E1111V possibly damaging Het
Sowaha C A 11: 53,370,182 (GRCm39) V185L probably benign Het
Spata4 A C 8: 55,055,585 (GRCm39) I159L probably benign Het
Spring1 A G 5: 118,393,759 (GRCm39) N46D probably benign Het
Tekt2 A G 4: 126,216,174 (GRCm39) I373T probably benign Het
Tle7 G T 8: 110,836,048 (GRCm39) R119I probably benign Het
Tomm20l T C 12: 71,164,313 (GRCm39) V65A probably benign Het
Trabd2b A G 4: 114,266,547 (GRCm39) D187G probably damaging Het
Trrap A G 5: 144,758,613 (GRCm39) I2147V possibly damaging Het
Tsc22d2 T A 3: 58,324,429 (GRCm39) C440* probably null Het
Ube3b A C 5: 114,544,313 (GRCm39) N570T probably damaging Het
Uevld A G 7: 46,600,724 (GRCm39) I70T probably damaging Het
Usp10 C T 8: 120,663,289 (GRCm39) T37I possibly damaging Het
Vmn2r23 T A 6: 123,689,981 (GRCm39) F286I probably benign Het
Vmn2r62 A G 7: 42,414,640 (GRCm39) V601A probably benign Het
Wdr81 G C 11: 75,336,828 (GRCm39) N401K Het
Ythdc2 G T 18: 44,966,189 (GRCm39) V142F probably benign Het
Zfp346 T C 13: 55,253,263 (GRCm39) F36S possibly damaging Het
Zfp748 C T 13: 67,690,358 (GRCm39) V301M possibly damaging Het
Zim1 T C 7: 6,681,220 (GRCm39) K148E possibly damaging Het
Other mutations in Fam243
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Fam243 APN 16 92,117,890 (GRCm39) missense possibly damaging 0.47
IGL01327:Fam243 APN 16 92,117,661 (GRCm39) missense probably benign 0.10
IGL02812:Fam243 APN 16 92,117,616 (GRCm39) missense probably damaging 0.98
IGL02981:Fam243 APN 16 92,117,757 (GRCm39) missense probably benign 0.05
R0458:Fam243 UTSW 16 92,117,995 (GRCm39) missense probably benign 0.00
R0826:Fam243 UTSW 16 92,118,075 (GRCm39) missense probably benign 0.05
R1456:Fam243 UTSW 16 92,117,553 (GRCm39) missense probably damaging 0.99
R1754:Fam243 UTSW 16 92,117,919 (GRCm39) missense probably damaging 0.98
R2568:Fam243 UTSW 16 92,118,207 (GRCm39) missense probably damaging 1.00
R5916:Fam243 UTSW 16 92,117,559 (GRCm39) missense probably damaging 1.00
R7195:Fam243 UTSW 16 92,118,037 (GRCm39) missense probably damaging 1.00
R7289:Fam243 UTSW 16 92,117,710 (GRCm39) missense probably damaging 1.00
R7638:Fam243 UTSW 16 92,117,805 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGACAAAACTCCTTCCG -3'
(R):5'- ACATTCACACACCATCGTGG -3'

Sequencing Primer
(F):5'- GACAAAACTCCTTCCGGTTGTTTATG -3'
(R):5'- TGTATCCTACACGCTGGGG -3'
Posted On 2019-05-15