Incidental Mutation 'R7148:Flywch1'
ID553978
Institutional Source Beutler Lab
Gene Symbol Flywch1
Ensembl Gene ENSMUSG00000040097
Gene NameFLYWCH-type zinc finger 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23752793-23771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23755675 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 664 (K664E)
Ref Sequence ENSEMBL: ENSMUSP00000040022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325]
Predicted Effect probably benign
Transcript: ENSMUST00000045517
AA Change: K664E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097
AA Change: K664E

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 83 1.2e-24 PFAM
Pfam:FLYWCH 92 150 7e-17 PFAM
Pfam:FLYWCH 235 293 3.3e-17 PFAM
low complexity region 352 380 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
Pfam:FLYWCH 402 460 9.7e-18 PFAM
Pfam:FLYWCH 490 548 7.9e-18 PFAM
Pfam:FLYWCH 581 639 6.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086325
AA Change: K664E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097
AA Change: K664E

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 84 9.7e-10 PFAM
Pfam:FLYWCH 92 150 3.8e-17 PFAM
Pfam:FLYWCH 235 293 3.1e-17 PFAM
Pfam:FLYWCH_u 294 401 1.3e-30 PFAM
Pfam:FLYWCH 402 460 9.1e-18 PFAM
Pfam:FLYWCH 490 548 6.8e-18 PFAM
Pfam:FLYWCH_u 549 568 9.1e-3 PFAM
Pfam:FLYWCH 581 639 4.7e-17 PFAM
Pfam:FLYWCH_u 640 672 4.6e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227120
AA Change: K617E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Flywch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Flywch1 APN 17 23763026 missense probably benign 0.01
IGL01843:Flywch1 APN 17 23760345 missense possibly damaging 0.89
IGL02110:Flywch1 APN 17 23763092 splice site probably null
IGL02586:Flywch1 APN 17 23755702 missense probably benign 0.04
IGL02870:Flywch1 APN 17 23755902 missense probably damaging 1.00
IGL02877:Flywch1 APN 17 23760414 missense probably damaging 1.00
lubdub UTSW 17 23761059 missense possibly damaging 0.93
R0830:Flywch1 UTSW 17 23762370 missense probably benign 0.00
R1411:Flywch1 UTSW 17 23755824 missense probably damaging 1.00
R2044:Flywch1 UTSW 17 23762313 nonsense probably null
R2153:Flywch1 UTSW 17 23755650 missense probably benign 0.21
R2314:Flywch1 UTSW 17 23763026 missense probably benign 0.01
R2497:Flywch1 UTSW 17 23755711 missense probably benign 0.27
R3022:Flywch1 UTSW 17 23763108 missense probably benign 0.00
R3625:Flywch1 UTSW 17 23760201 splice site probably benign
R3691:Flywch1 UTSW 17 23763212 missense probably damaging 0.96
R4805:Flywch1 UTSW 17 23760617 missense probably benign 0.16
R5321:Flywch1 UTSW 17 23756651 missense probably damaging 1.00
R7200:Flywch1 UTSW 17 23761059 missense possibly damaging 0.93
R7629:Flywch1 UTSW 17 23755770 missense probably benign 0.06
R8362:Flywch1 UTSW 17 23756708 missense probably damaging 1.00
R8762:Flywch1 UTSW 17 23756757 missense probably damaging 1.00
RF003:Flywch1 UTSW 17 23762166 frame shift probably null
RF007:Flywch1 UTSW 17 23762164 frame shift probably null
RF007:Flywch1 UTSW 17 23762171 frame shift probably null
RF009:Flywch1 UTSW 17 23762161 frame shift probably null
RF010:Flywch1 UTSW 17 23762175 frame shift probably null
RF013:Flywch1 UTSW 17 23762175 frame shift probably null
RF018:Flywch1 UTSW 17 23762166 frame shift probably null
RF022:Flywch1 UTSW 17 23762167 frame shift probably null
RF027:Flywch1 UTSW 17 23762158 frame shift probably null
RF031:Flywch1 UTSW 17 23762158 frame shift probably null
RF038:Flywch1 UTSW 17 23762164 frame shift probably null
RF040:Flywch1 UTSW 17 23762169 frame shift probably null
RF041:Flywch1 UTSW 17 23762161 frame shift probably null
RF041:Flywch1 UTSW 17 23762177 frame shift probably null
RF046:Flywch1 UTSW 17 23762169 frame shift probably null
RF046:Flywch1 UTSW 17 23762174 frame shift probably null
RF049:Flywch1 UTSW 17 23762171 frame shift probably null
RF058:Flywch1 UTSW 17 23762177 frame shift probably null
X0009:Flywch1 UTSW 17 23755655 small deletion probably benign
X0028:Flywch1 UTSW 17 23761095 missense probably damaging 1.00
Z1176:Flywch1 UTSW 17 23761009 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCAAGAGACAACCAGCTCTAAGTG -3'
(R):5'- GCTGCTGGTGAGAAAGTGTAC -3'

Sequencing Primer
(F):5'- ACCAGCTCTAAGTGTTGAGC -3'
(R):5'- TACTGGATGTGTCGAGACCAG -3'
Posted On2019-05-15