Incidental Mutation 'R7148:Ythdc2'
ID553980
Institutional Source Beutler Lab
Gene Symbol Ythdc2
Ensembl Gene ENSMUSG00000034653
Gene NameYTH domain containing 2
Synonyms3010002F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location44827746-44889724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44833122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 142 (V142F)
Ref Sequence ENSEMBL: ENSMUSP00000048340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037763]
Predicted Effect probably benign
Transcript: ENSMUST00000037763
AA Change: V142F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: V142F

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
Pfam:R3H 59 119 1.7e-15 PFAM
DEXDc 206 393 4.95e-26 SMART
low complexity region 413 428 N/A INTRINSIC
ANK 521 550 2.79e1 SMART
ANK 554 583 1.5e2 SMART
HELICc 648 759 5.31e-17 SMART
HA2 823 916 2.58e-22 SMART
Pfam:OB_NTP_bind 953 1082 1.3e-18 PFAM
low complexity region 1263 1299 N/A INTRINSIC
Pfam:YTH 1303 1434 7.2e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Ythdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ythdc2 APN 18 44859973 missense probably benign
IGL00341:Ythdc2 APN 18 44850397 missense probably benign 0.00
IGL00502:Ythdc2 APN 18 44847812 missense probably damaging 0.99
IGL00585:Ythdc2 APN 18 44864361 missense probably damaging 1.00
IGL01081:Ythdc2 APN 18 44850659 missense probably benign 0.19
IGL01569:Ythdc2 APN 18 44887651 missense probably benign
IGL01577:Ythdc2 APN 18 44858282 missense probably benign 0.00
IGL01617:Ythdc2 APN 18 44841415 missense possibly damaging 0.53
IGL01674:Ythdc2 APN 18 44860404 missense probably benign 0.04
IGL01736:Ythdc2 APN 18 44850668 missense probably damaging 0.97
IGL02095:Ythdc2 APN 18 44873140 splice site probably benign
IGL02245:Ythdc2 APN 18 44862684 missense possibly damaging 0.74
IGL02524:Ythdc2 APN 18 44847854 missense probably damaging 0.98
IGL02542:Ythdc2 APN 18 44840241 missense probably damaging 1.00
IGL02622:Ythdc2 APN 18 44859934 missense probably damaging 0.99
IGL02795:Ythdc2 APN 18 44837438 missense possibly damaging 0.95
IGL02935:Ythdc2 APN 18 44855045 missense probably damaging 1.00
PIT4618001:Ythdc2 UTSW 18 44834598 missense probably benign 0.19
R0115:Ythdc2 UTSW 18 44841423 splice site probably benign
R0329:Ythdc2 UTSW 18 44865060 splice site probably benign
R0472:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R0530:Ythdc2 UTSW 18 44850398 missense probably damaging 0.99
R0547:Ythdc2 UTSW 18 44840264 missense possibly damaging 0.92
R0563:Ythdc2 UTSW 18 44864848 splice site probably benign
R0609:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R1291:Ythdc2 UTSW 18 44855209 missense probably benign 0.33
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1724:Ythdc2 UTSW 18 44828690 missense probably benign 0.04
R1860:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R2040:Ythdc2 UTSW 18 44855174 nonsense probably null
R2308:Ythdc2 UTSW 18 44847748 missense possibly damaging 0.95
R3711:Ythdc2 UTSW 18 44833173 missense probably damaging 0.98
R4005:Ythdc2 UTSW 18 44833128 missense probably benign 0.00
R4580:Ythdc2 UTSW 18 44858198 missense possibly damaging 0.81
R4631:Ythdc2 UTSW 18 44887631 missense probably benign 0.03
R4815:Ythdc2 UTSW 18 44885240 missense probably benign 0.40
R4924:Ythdc2 UTSW 18 44847804 missense probably damaging 1.00
R4982:Ythdc2 UTSW 18 44871465 missense probably benign 0.01
R5011:Ythdc2 UTSW 18 44854742 missense probably benign 0.38
R5141:Ythdc2 UTSW 18 44865047 missense probably benign 0.01
R5147:Ythdc2 UTSW 18 44844292 missense probably damaging 0.98
R5280:Ythdc2 UTSW 18 44860621 missense probably damaging 1.00
R5388:Ythdc2 UTSW 18 44857025 missense possibly damaging 0.65
R5928:Ythdc2 UTSW 18 44833205 missense probably benign
R5931:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R5995:Ythdc2 UTSW 18 44886253 missense probably damaging 1.00
R6027:Ythdc2 UTSW 18 44860436 missense probably benign 0.02
R6056:Ythdc2 UTSW 18 44840210 missense probably damaging 0.98
R6318:Ythdc2 UTSW 18 44860377 missense probably benign 0.04
R6399:Ythdc2 UTSW 18 44886402 missense possibly damaging 0.93
R6586:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R6684:Ythdc2 UTSW 18 44873069 missense possibly damaging 0.47
R7040:Ythdc2 UTSW 18 44834462 missense probably benign 0.02
R7071:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R7105:Ythdc2 UTSW 18 44834563 missense probably damaging 1.00
R7290:Ythdc2 UTSW 18 44837491 missense possibly damaging 0.50
R7806:Ythdc2 UTSW 18 44844286 missense possibly damaging 0.91
R7806:Ythdc2 UTSW 18 44850424 missense probably benign 0.05
R8114:Ythdc2 UTSW 18 44877740 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCTAAGTAGGCATACATCGTGTG -3'
(R):5'- CACATGGTAACTATTCAATGAGCAG -3'

Sequencing Primer
(F):5'- TAGGCATACATCGTGTGTGAAC -3'
(R):5'- GAGCAGTAGTTATTATGACAACCTTC -3'
Posted On2019-05-15