Mutagenetix > Incidental Mutations

Incidental Mutation 'R7148:Apcdd1'

553981

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R7148 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62951845 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 371 (V371A)

Ref Sequence

ENSEMBL: ENSMUSP00000094302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096554
AA Change: V371A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: V371A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163716
AA Change: V371A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: V371A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024G13Rik	T	A	14: 32,388,312	Y14F	probably damaging	Het
2410131K14Rik	A	G	5: 118,255,694	N46D	probably benign	Het
4930563D23Rik	T	C	16: 92,320,987	K138E	probably benign	Het
Acly	A	G	11: 100,483,782	V805A	possibly damaging	Het
AF366264	T	A	8: 13,837,996	I32L	probably benign	Het
Cacna1g	A	T	11: 94,465,930	F127I	probably benign	Het
Ccdc129	T	C	6: 55,897,686	I207T	probably damaging	Het
Ccdc138	T	C	10: 58,538,280	L374P	probably damaging	Het
Ces2b	A	G	8: 104,838,296	Y504C	probably damaging	Het
Ces5a	C	T	8: 93,502,322	G427S	probably damaging	Het
Chd1l	C	T	3: 97,591,316	V256M	probably damaging	Het
Col24a1	C	T	3: 145,315,299	T477M	probably damaging	Het
Dmbt1	T	A	7: 131,066,734	C573*	probably null	Het
Emcn	A	T	3: 137,417,094	Y188F	possibly damaging	Het
Eva1a	T	G	6: 82,071,144	M1R	probably null	Het
Fam83h	C	A	15: 76,005,167	D194Y	probably damaging	Het
Flywch1	T	C	17: 23,755,675	K664E	probably benign	Het
Fzd9	A	G	5: 135,249,690	V447A	probably benign	Het
Gm21964	G	T	8: 110,109,416	R119I	probably benign	Het
Heatr5b	T	C	17: 78,831,434	D93G	probably damaging	Het
Hmcn1	T	C	1: 150,686,854	I2318V	probably benign	Het
Hyal5	T	A	6: 24,876,902	L258Q	probably damaging	Het
Kmo	T	A	1: 175,651,602	C235S	probably damaging	Het
Lamc2	G	A	1: 153,185,984	P2S	probably benign	Het
Lman2	G	A	13: 55,352,949	P146S	probably benign	Het
Mars2	T	C	1: 55,237,514	I92T	probably damaging	Het
Msh3	A	G	13: 92,354,822	F27L	probably benign	Het
Myom2	T	C	8: 15,084,577	V460A	possibly damaging	Het
Nicn1	T	A	9: 108,295,107	*214R	probably null	Het
Nsd2	T	C	5: 33,885,511	F1040L	possibly damaging	Het
Olfr374	T	A	8: 72,110,157	I197N	possibly damaging	Het
Osm	T	A	11: 4,239,936	I240N	probably benign	Het
Pard3b	T	A	1: 62,440,032	D884E	probably benign	Het
Pex5	T	G	6: 124,405,272	D150A	probably benign	Het
Pfkfb4	T	C	9: 109,027,608	V394A	probably damaging	Het
Pjvk	A	G	2: 76,658,487	K334R	possibly damaging	Het
Pkd1l2	T	C	8: 117,080,786	D171G	probably benign	Het
Prpf4b	T	G	13: 34,894,472	N688K	probably benign	Het
R3hcc1	T	C	14: 69,705,552	E192G	possibly damaging	Het
Rad54l2	C	A	9: 106,719,119	G207*	probably null	Het
Rhobtb3	G	T	13: 75,910,887	T264K	probably benign	Het
Rpl27	A	G	11: 101,442,406		probably benign	Het
Rxfp3	C	T	15: 11,036,777	V170I	possibly damaging	Het
Samd4	T	A	14: 47,016,683	S201R	probably benign	Het
Sell	A	G	1: 164,065,607	I131V	possibly damaging	Het
Sirpb1c	A	T	3: 15,833,059	Y205*	probably null	Het
Smc3	A	T	19: 53,641,895	E1111V	possibly damaging	Het
Sowaha	C	A	11: 53,479,355	V185L	probably benign	Het
Spata4	A	C	8: 54,602,550	I159L	probably benign	Het
Tekt2	A	G	4: 126,322,381	I373T	probably benign	Het
Tomm20l	T	C	12: 71,117,539	V65A	probably benign	Het
Trabd2b	A	G	4: 114,409,350	D187G	probably damaging	Het
Trrap	A	G	5: 144,821,803	I2147V	possibly damaging	Het
Tsc22d2	T	A	3: 58,417,008	C440*	probably null	Het
Ube3b	A	C	5: 114,406,252	N570T	probably damaging	Het
Uevld	A	G	7: 46,950,976	I70T	probably damaging	Het
Usp10	C	T	8: 119,936,550	T37I	possibly damaging	Het
Vmn2r23	T	A	6: 123,713,022	F286I	probably benign	Het
Vmn2r62	A	G	7: 42,765,216	V601A	probably benign	Het
Wdr81	G	C	11: 75,446,002	N401K		Het
Ythdc2	G	T	18: 44,833,122	V142F	probably benign	Het
Zfp346	T	C	13: 55,105,450	F36S	possibly damaging	Het
Zfp748	C	T	13: 67,542,239	V301M	possibly damaging	Het
Zim1	T	C	7: 6,678,221	K148E	possibly damaging	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCATATGGAACTTCCTACCAGAG -3'
(R):5'- GCCATTGAACAGCAGGTAGC -3'

Sequencing Primer
(F):5'- TATGGAACTTCCTACCAGAGCCTAC -3'
(R):5'- GGTGTCTTGCTCCATTTTGAAGATC -3'

Posted On

2019-05-15