Incidental Mutation 'R7148:Smc3'
ID553982
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Namestructural maintenance of chromosomes 3
SynonymsSmcD, Mmip1, Bamacan, Cspg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53600398-53645833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53641895 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1111 (E1111V)
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
PDB Structure SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025930
AA Change: E1111V

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974
AA Change: E1111V

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53629327 missense probably damaging 0.99
IGL01300:Smc3 APN 19 53641852 splice site probably benign
IGL02136:Smc3 APN 19 53635716 missense probably benign 0.02
IGL02216:Smc3 APN 19 53621844 missense probably damaging 1.00
IGL02473:Smc3 APN 19 53636448 missense probably benign 0.06
IGL02797:Smc3 APN 19 53638758 missense probably benign 0.03
IGL02959:Smc3 APN 19 53623557 missense probably benign 0.00
IGL03343:Smc3 APN 19 53613842 missense probably damaging 1.00
Bits UTSW 19 53623218 critical splice donor site probably null
Pieces UTSW 19 53629371 missense probably damaging 0.99
Smithereens UTSW 19 53641931 missense probably damaging 1.00
R0081:Smc3 UTSW 19 53601562 splice site probably benign
R0940:Smc3 UTSW 19 53640909 missense probably benign 0.10
R1248:Smc3 UTSW 19 53634078 missense probably benign 0.01
R1661:Smc3 UTSW 19 53625065 missense probably benign 0.08
R1779:Smc3 UTSW 19 53639369 missense probably benign 0.02
R2046:Smc3 UTSW 19 53639414 missense probably benign 0.00
R2073:Smc3 UTSW 19 53631533 missense probably benign 0.08
R2074:Smc3 UTSW 19 53631533 missense probably benign 0.08
R3077:Smc3 UTSW 19 53627891 missense probably benign 0.16
R4962:Smc3 UTSW 19 53631517 missense probably damaging 0.99
R5684:Smc3 UTSW 19 53640804 missense probably benign 0.00
R6020:Smc3 UTSW 19 53625163 critical splice donor site probably null
R6169:Smc3 UTSW 19 53634086 missense probably benign 0.02
R6221:Smc3 UTSW 19 53641931 missense probably damaging 1.00
R6258:Smc3 UTSW 19 53627731 splice site probably null
R6960:Smc3 UTSW 19 53629371 missense probably damaging 0.99
R7048:Smc3 UTSW 19 53629251 missense probably benign 0.01
R7157:Smc3 UTSW 19 53641898 missense probably damaging 1.00
R7805:Smc3 UTSW 19 53640959 missense probably benign 0.26
R7968:Smc3 UTSW 19 53623218 critical splice donor site probably null
R8066:Smc3 UTSW 19 53615145 missense probably damaging 1.00
R8202:Smc3 UTSW 19 53628692 missense possibly damaging 0.94
R8472:Smc3 UTSW 19 53628711 missense probably benign 0.02
R8683:Smc3 UTSW 19 53641185 missense possibly damaging 0.50
X0026:Smc3 UTSW 19 53625120 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCAGTGTTCCATCAGTTGACC -3'
(R):5'- CCCACAGCAAGTTCTCACTG -3'

Sequencing Primer
(F):5'- TCAGTTGACCAGTTCACAGG -3'
(R):5'- TGAACAGAAATCAGAACTGTACCTG -3'
Posted On2019-05-15